Lister's gecko, Reference genome (HiC), Illumina-HiC, Heart_liver_tail
Dataset size is: 70.10 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
Access Control Date | 2023-07-13 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | Open Access |
ala_specimen_url | https://bie.ala.org.au/species/urn:lsid:biodiversity.org.au:afd.taxon:4e9782f1-53d6-47cd-9d01-7a04a78b94e9 |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/ |
ccg_jira_ticket | BPAOPS-1309 |
certainty | High |
class | Reptillia |
collection_date | 2021-02-09 |
collection_method | Medical euthanasia |
collector | Claire Ford |
collector_sample_id | LG448 |
common_name | Lister's gecko |
country | Australia |
data_context | Reference genome (HiC) |
data_custodian | Carolyn Hogg |
data_type | Illumina-HiC |
dataset_id | 102.100.100/358786 |
date_of_transfer | 2022-07-13 |
date_of_transfer_to_archive | 2022-08-09 |
death_date | 2021-02-09 |
decimal_latitude_public | -33.8 |
decimal_longitude_public | 151.2 |
description | Hi-C multiple species |
dna_treatment | FA crosllinking restriction enzymes and sonication |
download | researcher informed |
experimental_design | Arima HiC 2.0 single index |
facility_project_code | BRF |
facility_sample_id | 408044_AusARG_BRF_XXXXX_CCGTCC |
family | Gekkonidae |
file_type | FASTQ |
flowcell_id | HG5YLDMXY |
flowcell_type | Novaseq S2 |
folder_name | 20220711_TSI_BRF_HG5YLDMXY |
genus | Lepidodactylus |
habitat | Rainforest |
health_state | Poor - severe gout |
insert_size_range | 150bp PE |
institution_name | University of Sydney |
latitude | -33.8 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 408044 |
library_index_id | Index_16 |
library_index_seq | CCGTCC |
library_layout | paired end |
library_location | Freezer at BRF |
library_ng_ul | 1.6 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCC(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2022-06-30 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | adult |
location_text | Mosman |
longitude | 151.2 |
metadata_revision_date | 2024-08-28 |
metadata_revision_filename | 20240829_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
method_of_determination | Dissection |
n_libraries_pooled | 6 |
order | Squamata |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | ddRAD |
sample_custodian | Carolyn Hogg |
sample_id | 102.100.100/405659 |
sample_quality | Poor |
sample_type | Organ |
scientific_name | Lepidodactylus listeri |
scientific_name_authorship | Boulenger |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq v1.5 |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
source_population | Taronga Zoo |
species | listeri |
specimen_id | LG448 |
specimen_id_description | Taronga Zoo ID |
state_or_region | New South Wales |
taxon_id | 747221.0 |
taxonomic_group | Reptile |
ticket | BPAOPS-1309 |
tissue_collection | Euthanasia |
tissue_collection_type | Living collection - zoo |
tissue_number | LG448_heart_liver_tail |
tissue_preservation | Preserved in ethanol |
tissue_preservation_temperature | "-20C" |
tissue_type | Heart_liver_tail |
wild_captive | captive |
work_order | 13045 |