green and golden bell frog, Reference genome (HiC), Illumina-HiC, muscle structure
Dataset size is: 134.72 GiB
This dataset is currently under a short embargo period until July 31, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2024-07-31 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | no restrictions |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/genomics-hi-c/BPAOPS-1309/20220711_TSI_BRF_HG5YLDMXY/ |
| ccg_jira_ticket | BPAOPS-1309 |
| certainty | certain |
| class | Amphibia |
| collection_method | Frog was removed from outdoor enclosure by hand |
| collector | Anthony Waddle, University of Melbourne/Macquarie University |
| collector_sample_id | MaleTub17 |
| common_name | green and golden bell frog |
| country | Australia |
| data_context | Reference genome (HiC) |
| data_custodian | Anthony Wardle |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/358779 |
| date_of_transfer | 2022-07-13 |
| date_of_transfer_to_archive | 2022-08-09 |
| description | Hi-C multiple species |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| download | researcher informed |
| experimental_design | Arima HiC 2.0 single index |
| facility_project_code | BRF |
| facility_sample_id | 408028_AusARG_BRF_XXXXX_GTCCGC |
| family | Pelodryadidae |
| file_type | FASTQ |
| flowcell_id | HG5YLDMXY |
| flowcell_type | Novaseq S2 |
| folder_name | 20220711_TSI_BRF_HG5YLDMXY |
| genus | Litoria |
| habitat | Waste emplacement dam |
| insert_size_range | 150bp PE |
| institution_name | Macquarie University |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 408028 |
| library_index_id | Index_18 |
| library_index_seq | GTCCGC |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGC(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 6 |
| library_pcr_reps | 1 |
| library_prep_date | 2022-06-30 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | adult organism |
| location_text | Kooragang Island |
| material_extracted_by | Anthony Waddle |
| material_extraction_type | DNA |
| metadata_revision_date | 2023-11-30 |
| metadata_revision_filename | 20231130_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| method_of_determination | conspicuous sexual characteristics such as nuptual pads and coloured throat patch. |
| n_libraries_pooled | 6 |
| order | Anura |
| phenotypic_sex | male |
| phylum | Chordata |
| sample_custodian | Anthony Waddle, Rick Shine, Simon Clulow |
| sample_id | 102.100.100/405646 |
| sample_quality | Flash Frozen |
| sample_type | tissue sample |
| scientific_name | Litoria aurea |
| scientific_name_authorship | Lesson, 1829 |
| scientific_name_note | sometimes called Ranoidea aurea |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | NovaSeq v1.5 |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Kooragang Island |
| species | aurea |
| specimen_id | 356208.0 |
| specimen_id_description | Specimen is a male Litoria aurea from Macquarie University Fauna Park Colony taken from tub 17 in July 2021 |
| state_or_region | New South Wales |
| subspecies | n/a |
| taxon_id | 312085.0 |
| taxonomic_group | Amphibian |
| ticket | BPAOPS-1309 |
| tissue_collection | MQ-MLA017 |
| tissue_collection_type | university |
| tissue_number | MQ-MLA017Muscle |
| tissue_preservation | -80C |
| tissue_preservation_temperature | -80C |
| tissue_type | muscle structure |
| wild_captive | captive |
| work_order | 13045 |