waddy, Population Genetics, Illumina FASTQ, Phyllode sample
Dataset size is: 110.94 GiB
This dataset is currently under a short embargo period until April 19, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
| Access Control Date | 2025-04-19 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| access_rights | Location information restricted |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1576/20240306_TSI_AGRF_22JM2GLT3/ |
| bioplatforms_project | Threatened Species Initiative |
| bpa_dataset_id | 102.100.100/358847 |
| class | Magnoliopsida |
| collection_date | 2014-01-01 |
| collector | John Luly |
| common_name | waddy |
| country | Australia |
| data_context | Population Genetics |
| data_custodian | Korjent van Dijk |
| data_type | Illumina FASTQ |
| dataset_id | 102.100.100/358847 |
| date_of_transfer | 2024-04-19 |
| date_of_transfer_to_archive | 2024-04-22 |
| decimal_latitude_public | -25.42 |
| decimal_longitude_public | 139.18 |
| description | Illumina ddRAD-seq |
| experimental_design | EcoRI/NlaIII |
| facility_project_code | CAGRF230313975 |
| family | Fabaceae |
| flowcell_id | 22JM2GLT3 |
| flowcell_type | 10B |
| folder_name | 20240306_TSI_AGRF_22JM2GLT3 |
| genus | Acacia |
| insert_size_range | 280 - 375 (Wide) |
| institution_name | University of Adelaide |
| latitude | -25.42 |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_index_id_dual | PP7i12 |
| library_index_seq_dual | CTTGTA |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_ng_ul | 3.14 |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_oligo_sequence_dual | CAAGCAGAAGACGGCATACGAGAtTACAAGGTGACTGGAGTTCAGACGTGTG*C |
| library_pcr_cycles | 11.0 |
| library_pcr_reps | 7.0 |
| library_prep_date | 2024-02-26 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | ddRAD |
| location_text | Site G |
| longitude | 139.18 |
| material_conc_ng_ul | unknown |
| material_extracted_by | Jessica Burdon |
| material_extraction_date | 2018-05-03 |
| material_extraction_method | Qiagen Plant Mini Kit |
| metadata_revision_date | 2023-11-30 |
| metadata_revision_filename | 20231130_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
| n_libraries_pooled | 1.0 |
| order | Fabales |
| phenotypic_sex | monoecious |
| phylum | Magnoliophyta |
| sample_custodian | Michelle Waycott |
| sample_quality | Some DNA degradation |
| sample_type | tissue sample |
| scientific_name | Acacia peuce |
| scientific_name_authorship | F.Muell. |
| sequencing_facility | AGRF_Melbourne |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | Birdsville |
| species | peuce |
| specimen_id_description | Uni_Adl_Waycot_Lab |
| state_or_region | Queensland |
| taxon_id | 1174866.0 |
| taxonomic_group | Plant |
| ticket | BPAOPS-1576 |
| tissue_collection | Waycott_Lab |
| tissue_collection_type | university, private |
| tissue_preservation | Dry Silica Gel |
| tissue_preservation_temperature | Room Temp |
| tissue_type | Phyllode sample |
| type_status | unknown |
| wild_captive | wild |
| work_order | 14047 |