Spidery wattle/Balcanoona wattle, Population genetics, Illumina FASTQ, Leaf
Dataset size is: 38.78 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:tsi-consortium-members |
Access Control Date | 2023-05-25 |
Access Control Mode | date |
Sequence Data Type | illumina-ddrad |
access_rights | location information |
associated_media | photo |
base_url | https://downloads-qcif.bioplatforms.com/bpa/tsi_staging/ddrad/BPAOPS-1265/AGRF_TSI_H7KHDRX2_358765/ |
bpa_dataset_id | 102.100.100/358765 |
class | Magnoliopsida |
collection_date | 2021-10-10 |
collection_method | Removal of leaves from living plant, and storing on silica gel. Refer to methods in https://doi.org/10.3390/d12080346 |
collector | Colette Blyth, Shannon Evendon, University of Adelaide |
common_name | Spidery wattle/Balcanoona wattle |
country | Australia |
data_context | Population genetics |
data_custodian | Colette Blyth |
data_type | Illumina FASTQ |
dataset_id | 102.100.100/358765 |
date_of_transfer | 2022-05-25 |
date_of_transfer_to_archive | 2022-05-26 |
decimal_latitude_public | -30.334664 |
decimal_longitude_public | 139.334664 |
description | ddRAD (dataset ID 358765) |
experimental_design | PstI and MseI |
facility_project_code | QAGRF22019383 |
family | Leguminosae |
flowcell_id | H7KHFDRX2 |
flowcell_type | S1 300 |
folder_name | AGRF_TSI_H7KHDRX2_358765 |
genotypic_sex | Not determined |
genus | Acacia |
habitat | Arid, mounatinous |
health_state | healthy |
insert_size_range | 280-342 |
institution_name | University of Adelaide |
latitude | -30.334664 |
library_construction_protocol | ddRAD (based on Peterson et al 2012) |
library_index_id_dual | PP7i4 |
library_index_seq_dual | TGACCA |
library_location | AGRF Melbourne |
library_ng_ul | 2.21 |
library_oligo_sequence_dual | CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTG*C |
library_pcr_cycles | 11.0 |
library_pcr_reps | 7.0 |
library_prep_date | 2022-04-12 |
library_prepared_by | Simon Farrelly |
library_selection | Reduced Representation |
library_source | Genomic |
library_strategy | RAD-Seq |
library_type | ddRAD |
lifestage | seedling |
location_text | Arkaroola sanctuary. ~2km south of Arkaroola village |
longitude | 139.334664 |
metadata_revision_date | 2023-11-30 |
metadata_revision_filename | 20231130_Sample_metadata_COMBINED-FOR-PORTAL_NOLATLON.xlsx |
n_libraries_pooled | 1.0 |
order | Fabales |
phenotypic_sex | not determined |
phylum | Spermatophyta |
sample_custodian | Coletter Blyth, University of Adelaide |
sample_quality | Good |
sample_type | Leaf tissue |
scientific_name | Acacia araneosa |
scientific_name_authorship | D.J.E. Whibley 1976 |
sequencing_facility | AGRF Melbourne |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
species | araneosa |
specimen_id_description | University of adelaide - Advanced DNA, Identification and Forensic Facility internal identifier |
state_or_region | South Australia |
taxon_id | 1174718.0 |
taxonomic_group | Plant |
ticket | BPAOPS-1265 |
tissue_collection_type | University |
tissue_preservation | Silica gel |
tissue_preservation_temperature | Room temperature |
tissue_type | Leaf |
work_order | 14022 |