Plant Pathogen, Genomics, PromethION, Sample ID 395708
Dataset size is: 589.62 GiB
This dataset is currently under a short embargo period until August 15, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
395708_LibID398367_PP_BRF_PBA017... Metadata Only TAR
-
PP_BRF_PBA01787_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
PP_BRF_PBA01787_ONTPromethION_ba... Metadata Only
-
PP_BRF_PBA01787_ONTPromethION_se... Metadata Only
-
395708_LibID398367_PP_BRF_PBA017... Metadata Only TAR
-
PP_BRF_PBA01787_ONTPromethION_re... Metadata Only HTML
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044 |
| Access Control Date | 2025-08-15 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 24.02.19 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1647/20240802_PP_BRF_PBA01787/ |
| bioplatforms_dataset_id | 102.100.100/399067 |
| bioplatforms_library_id | 102.100.100/398367 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP044_Puccinia_2 |
| bioplatforms_sample_id | 102.100.100/395708 |
| ccg_jira_ticket | BPAOPS-1647 |
| cell_postion | 2G |
| class | Pucciniomycetes |
| common_name | Stripe rust fungus |
| country | Australia |
| data_context | Genomics |
| data_type | ONT |
| date_data_published | 20/08/2024 |
| date_of_transfer | 2024-08-15 |
| date_of_transfer_to_archive | 2024-08-16 |
| description | PromethION - dataset 12 |
| dna_treatment | 2nd strand cDNA synthesis from poly-A enriched DNA, direct cDNA synthesis, no PCRs |
| download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket%3ABPAOPS-1647 |
| facility | BRF |
| facility_sample_id | ONT_Lib6_683-6 |
| family | Pucciniaceae |
| fast5_compression | vbz |
| flowcell_id | PBA01787 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20240802_PP_BRF_PBA01787 (sample ID 395641 - 395708, not consecutive) |
| genus | Puccinia |
| host_common_name | Bread wheat |
| host_family | Poaceae |
| host_organ | Leaf |
| host_scientific_name | Triticum aestivum |
| host_status | Cereal crop |
| host_symptom | Fungal spores on leaves |
| insert_size_range | 1500.0 |
| isolate | Pst239E |
| library_comments | poly-A enrichment of total RNA from infected wheat plants or fungal spores, followed by 2nd strand cDNA synthesis and native ONT barcoding |
| library_construction_protocol | SQK-NBD114.96 |
| library_id | 398367 |
| library_index_id | barcode48 |
| library_index_id_dual | NA |
| library_index_seq | CATCTGGAACGTGGTACACCTGTA |
| library_index_seq_dual | NA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 35.6 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_oligo_sequence_dual | NA |
| library_pcr_cycles | NA |
| library_pcr_reps | NA |
| library_prep_date | 2024-06-03 |
| library_prepared_by | Mareike Moeller |
| library_selection | samples were barcoded and pooled based on different time points and replicates |
| library_source | cDNA of infected plant material and spores |
| library_strategy | cDNA ligated with Nanopore native adapters |
| library_type | Direct cDNA |
| material_extraction_type | RNA |
| metadata_revision_date | 2025-02-27 |
| metadata_revision_filename | 2024-12-20_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| model_base_caller | Super-accurate basecalling, 400 bps |
| movie_length | NA |
| n_libraries_pooled | 36.0 |
| order | Pucciniales |
| phylum | Basidiomycota |
| project_lead | Benjamin Schwessinger / Mareike Moeller | Australian National University |
| sample_collection_type | University, greenhouse experiment |
| sample_custodian | Benjamin Schwessinger | ANU |
| sample_id | 395708 |
| sample_type | dormant spores |
| scientific_name | Puccinia striiformis f. sp. tritici |
| sequencing_facility | Biomolecular Resource Facility |
| sequencing_kit_chemistry_version | SQK-NBD114.96 |
| sequencing_model | PromethION24 |
| sequencing_platform | Oxford Nanopore |
| species | Puccinia striiformis |
| specimen_custodian | Benjamin Schwessinger | ANU |
| specimen_id | Pst239E |
| specimen_id_description | Puccinia striiformis f. sp. tritici (Pst), pathotype 239E |
| sub_species | Puccinia striiformis f. sp. tritici |
| taxon_id | 168172 |
| taxonomic_group | Fungi |
| ticket | BPAOPS-1647 |
| tissue | urediniospores, dormant, replicate 4 |
| work_order | pool 6 |