Plant Pathogen, Genomics, PromethION, Sample ID 395613
Dataset size is: 115.23 GiB
This dataset is currently under a short embargo period until October 31, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
PP_BRF_PAQ10940_ONTPromethION_re... Metadata Only HTML
-
PP_BRF_PAQ10940_ONTPromethION_se... Metadata Only
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
-
PP_BRF_PAQ10940_ONTPromethION_ba... Metadata Only
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
-
395613_LibID397867_PP_BRF_PAQ109... Metadata Only TAR
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj044 |
| Access Control Date | 2024-10-31 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| analysis_software | MinKNOW 23.07.12 |
| associated_media | https://journals.asm.org/doi/10.1128/mbio.01650-17 |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/ont-promethion/BPAOPS-1508/20231023_PP_BRF_PAQ10940/ |
| bioplatforms_dataset_id | 102.100.100/399044 |
| bioplatforms_library_id | 102.100.100/397867 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP044_Puccinia_2 |
| bioplatforms_sample_id | 102.100.100/395613 |
| ccg_jira_ticket | BPAOPS-1508 |
| cell_postion | 2H |
| class | Pucciniomycetes |
| collection_method | Field isolate, singule postule isolation |
| collection_permit | NA |
| collector | Colin Wellings |
| collector_sample_id | Plant Breeding Institute accession number 821559 =415 |
| common_name | Stripe rust fungus |
| country | Australia |
| data_context | Genomics |
| data_type | ONT |
| date_of_transfer | 2023-11-01 |
| date_of_transfer_to_archive | 2023-11-02 |
| description | PromethION |
| dna_treatment | unknown -prepared by client |
| facility | BRF |
| facility_sample_id | ONT_Lib1_555_3 |
| family | Pucciniaceae |
| fast5_compression | vbz |
| flowcell_id | PAQ10940 |
| flowcell_type | FLO-PRO114M |
| folder_name | 20231023_PP_BRF_PAQ10940 (sample ID 395613 - 395624) |
| genus | Puccinia |
| host_common_name | Bread wheat |
| host_family | Poaceae |
| host_organ | Leaf |
| host_scientific_name | Triticum aestivum |
| host_status | Cereal crop |
| host_symptom | Fungal spores on leaves |
| insert_size_range | 1400.0 |
| isolate | Pst104E |
| library_comments | Library prepared by client |
| library_construction_protocol | SQK-NBD114.96 |
| library_id | 397867 |
| library_index_id | barcode45 |
| library_index_id_dual | NA |
| library_index_seq | GATCCAACAGAGATGCCTTCAGTG |
| library_index_seq_dual | NA |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 9.92 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_oligo_sequence_dual | NA |
| library_pcr_cycles | unknown -prepared by client |
| library_pcr_reps | unknown -prepared by client |
| library_prepared_by | unknown -prepared by client |
| library_selection | unknown -prepared by client |
| library_source | unknown -prepared by client |
| library_strategy | cDNA ligated with Nanopore native adapters |
| library_type | cDNA |
| location_text | Wheat field in NSW |
| material_conc_ng_ul | 1040.0 |
| material_extracted_by | Mareike Moeller | ANU |
| material_extraction_date | 2023-09-14 |
| material_extraction_method | Trizol |
| material_extraction_type | RNA |
| metadata_revision_date | 2023-11-02 |
| metadata_revision_filename | 2023-10-09_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| model_base_caller | Super-accurate basecalling, 400 bps |
| movie_length | NA |
| n_libraries_pooled | 12.0 |
| order | Pucciniales |
| phylum | Basidiomycota |
| project_lead | Benjamin Schwessinger / Mareike Moeller | Australian National University |
| sample_collection_type | University, greenhouse experiment |
| sample_custodian | Benjamin Schwessinger | ANU |
| sample_id | 395613 |
| sample_type | Wheat leaf infected with stripe rust |
| scientific_name | Puccinia striiformis f. sp. tritici |
| sequencing_facility | Biomolecular Resource Facility |
| sequencing_kit_chemistry_version | SQK-NBD114.96 |
| sequencing_model | PromethION24 |
| sequencing_platform | Oxford Nanopore |
| species | Puccinia striiformis |
| specimen_custodian | Benjamin Schwessinger | ANU |
| specimen_id | Pst104E |
| specimen_id_description | Puccinia striiformis f. sp. tritici (Pst), pathotype 104E |
| state_or_region | NSW |
| sub_species | Puccinia striiformis f. sp. tritici |
| taxon_id | 168172 |
| taxonomic_group | Fungi |
| ticket | BPAOPS-1508 |
| tissue | Infected leaf, 10 dpi, replicate 1 |
| tissue_preservation | Snap frozen |
| tissue_preservation_temperature | -80C |