Plant Pathogen, Genomics, Illumina Shortread, Sample ID 396015
Dataset size is: 84.40 GiB
This dataset is currently under a short embargo period until December 4, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj046 |
Access Control Date | 2025-12-04 |
Access Control Mode | date |
Sequence Data Type | illumina-shortread |
analysis_software | DRAGEN Bcl2Fastq |
base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/illumina-shortread/BPAOPS-1725/ |
bioplatforms_dataset_id | 102.100.100/399074 |
bioplatforms_library_id | 102.100.100/398420 |
bioplatforms_project | Plant Pathogen Initiative |
bioplatforms_project_code | PP046_Meloidogyne |
bioplatforms_sample_id | 102.100.100/396015 |
ccg_jira_ticket | BPAOPS-1725 |
class | Chromadorea |
collection_date | 2024-11-26 |
collector | Yennefer, A. |
common_name | Northern root knot nematode |
country | Australia |
data_context | Genomics |
data_type | Hi-C |
date_data_published | 12/12/2024 |
date_of_transfer | 2024-12-04 |
date_of_transfer_to_archive | 2024-12-05 |
decimal_latitude_public | -27.49 |
decimal_longitude_public | 153.02 |
description | Illumina Short read |
dna_treatment | FA crosslinking |
download | https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1725 |
experimental_design | Arima HiC 2.0 |
facility | BRF |
facility_project_code | BRF |
facility_sample_id | 396015_LibID398420_PP_BRF_225MWJLT1_CAGTGACG |
family | Meloidogynidae |
flowcell_id | 225MWJLT1 |
flowcell_type | NovaSeq X 1.5B |
folder_name | 20241204_PP_BRF_WO20062_225MWJLT1 |
genus | Meloidogyne |
host_common_name | Tomato |
host_family | Solanaceae |
host_organ | Root |
host_scientific_name | Solanum lycopersicum |
host_status | Research culture |
host_symptom | Galling |
insert_size_range | ~600bp |
library_construction_protocol | HiC Arima 2.0 |
library_id | 398420 |
library_index_id | NEB_Set3_E12 |
library_index_sequence | CAGTGACG |
library_layout | Paired end |
library_location | BRF Freezer |
library_ng_ul | 1.3 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGTGACG(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 12 |
library_pcr_reps | 1 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction digest |
library_source | GENOMIC |
library_strategy | HiC |
library_type | HiC |
life_stage | adult |
location_text | Ecosciences Precinct, Brisbane, Queensland Department of Agriculture and Fisheries |
metadata_revision_date | 2025-02-27 |
metadata_revision_filename | 2024-12-20_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
n_libraries_pooled | 1.0 |
order | Rhabditida |
phylum | Nematoda |
project_lead | Daniel Huston | CSIRO |
sample_collection_type | Ethanol |
sample_custodian | Daniel Huston | CSIRO, ANIC |
sample_type | Infested roots |
scientific_name | Meloidogyne hapla |
scientific_name_authorship | Chitwood, 1949 |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
source_population | Unknown |
species | hapla |
specimen_custodian | CSIRO Australian National Insect Collection (ANIC); Nematology Section (Nema) |
specimen_id | ANIC NEMA eth 19872 |
specimen_id_description | Australian National Insect Collection; Nematology ethanol collection |
state_or_region | Queensland |
taxon_id | 6305 |
taxonomic_group | Nematode |
ticket | BPAOPS-1725 |
tissue | whole adult female |
tissue_preservation | Liquid nitrogen onto dry ice |
tissue_preservation_temperature | -78 C |
work_order | WO_20062 |