Plant Pathogen, Genomics, Illumina Shortread, Sample ID 396012

Meloidogyne arenaria, Daniel Huston | CSIRO

Dataset size is: 94.07 GiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj046
Access Control Date 2025-12-04
Access Control Mode date
Sequence Data Type illumina-shortread
analysis_software DRAGEN Bcl2Fastq
base_url https://downloads-qcif.bioplatforms.com/bpa/pp_staging/illumina-shortread/BPAOPS-1725/
bioplatforms_dataset_id 102.100.100/399074
bioplatforms_library_id 102.100.100/398417
bioplatforms_project Plant Pathogen Initiative
bioplatforms_project_code PP046_Meloidogyne
bioplatforms_sample_id 102.100.100/396012
ccg_jira_ticket BPAOPS-1725
class Chromadorea
collection_date 2024-11-26
collector Yennefer, A.
common_name Peanut root knot nematode
country Australia
data_context Genomics
data_type Hi-C
date_data_published 12/12/2024
date_of_transfer 2024-12-04
date_of_transfer_to_archive 2024-12-05
decimal_latitude_public -27.49
decimal_longitude_public 153.02
description Illumina Short read
dna_treatment FA crosslinking
download https://data.bioplatforms.com/dataset/?ext_search_by=&q=ticket:BPAOPS-1725
experimental_design Arima HiC 2.0
facility BRF
facility_project_code BRF
facility_sample_id 396012_LibID398417_PP_BRF_225MWJLT1_CTCTTGAT
family Meloidogynidae
flowcell_id 225MWJLT1
flowcell_type NovaSeq X 1.5B
folder_name 20241204_PP_BRF_WO20062_225MWJLT1
genus Meloidogyne
host_common_name Tomato
host_family Solanaceae
host_organ Root
host_scientific_name Solanum lycopersicum
host_status Research culture
host_symptom Galling
insert_size_range ~600bp
library_construction_protocol HiC Arima 2.0
library_id 398417
library_index_id NEB_Set3_B12
library_index_sequence CTCTTGAT
library_layout Paired end
library_location BRF Freezer
library_ng_ul 1.3
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTCTTGAT(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 12
library_pcr_reps 1
library_prepared_by Max Nekrasov
library_selection Restriction digest
library_source GENOMIC
library_strategy HiC
library_type HiC
life_stage adult
location_text Ecosciences Precinct, Brisbane, Queensland Department of Agriculture and Fisheries
metadata_revision_date 2025-02-27
metadata_revision_filename 2024-12-20_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx
n_libraries_pooled 1.0
order Rhabditida
phylum Nematoda
project_lead Daniel Huston | CSIRO
sample_collection_type Ethanol
sample_custodian Daniel Huston | CSIRO, ANIC
sample_type Infested roots
scientific_name Meloidogyne arenaria
scientific_name_authorship Göldi, 1892
sequencing_facility Biomolecular Research Facility - ANU
sequencing_model NovaSeq X
sequencing_platform Illumina
source_population Unknown
species arenaria
specimen_custodian CSIRO Australian National Insect Collection (ANIC); Nematology Section (Nema)
specimen_id ANIC NEMA eth 19869
specimen_id_description Australian National Insect Collection; Nematology ethanol collection
state_or_region Queensland
taxon_id 6304
taxonomic_group Nematode
ticket BPAOPS-1725
tissue whole adult female
tissue_preservation Liquid nitrogen onto dry ice
tissue_preservation_temperature -78 C
work_order WO_20062