Plant Pathogen, Genomics, Illumina Shortread, Sample ID 395839
Dataset size is: 2.59 GiB
This dataset is currently under a short embargo period until June 3, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:pp-prj045 |
| Access Control Date | 2025-06-03 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/pp_staging/illumina-shortread/BPAOPS-1592/20240531_PP_BRF_399055_LD3WL/ |
| bioplatforms_dataset_id | 102.100.100/399055 |
| bioplatforms_library_id | 102.100.100/398105 |
| bioplatforms_project | Plant Pathogen Initiative |
| bioplatforms_project_code | PP045_P_brassicae |
| bioplatforms_sample_id | 102.100.100/395839 |
| ccg_jira_ticket | BPAOPS-1592 |
| class | Phytomyxea |
| collection_date | 2023-11-28 |
| collector | Subhashini Marri |
| common_name | Clubroot |
| country | Australia |
| data_context | Genomics |
| data_type | Hi-C |
| date_data_published | 11/06/2024 |
| date_of_transfer | 2024-06-03 |
| date_of_transfer_to_archive | 2024-06-04 |
| description | Illumina Short Read (Hi-C) |
| download | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1592 |
| experimental_design | HiC |
| facility | BRF |
| facility_project_code | BRF |
| family | Plasmodiophoridae |
| flowcell_id | LD3WL |
| folder_name | 20240531_PP_BRF_399055_LD3WL |
| genus | Plasmodiophora |
| health_state | disease |
| host_common_name | Spider mustard |
| host_family | Brassicaceae |
| host_organ | Roots |
| host_scientific_name | Brassica juncea var. japonica |
| host_status | Cultivated crop |
| host_symptom | Galling |
| insert_size_range | 100-1000 |
| library_construction_protocol | Phase Genomics Proximo HiC (Fungal ) Kit |
| library_id | 398105 |
| library_index_id | A4 |
| library_index_id_dual | A4 |
| library_index_seq_dual | CGACACTT |
| library_index_sequence | CCACATTG |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 0.862 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCACATTGATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACCGACACTTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 12 |
| library_pcr_reps | 0 |
| library_prepared_by | Lachlan Morrison |
| library_strategy | HiC |
| library_type | Phase Genomics Proximo HiC (Fungal ) Kit |
| life_stage | unknown |
| location_info_restricted | yes |
| location_text | Maffra |
| material_conc_ng_ul | 180 mg wet weight |
| material_extracted_by | Maxim Prokchorchik | University of Sydney |
| material_extraction_date | 2024-05-08 |
| material_extraction_method | gradient centrifugation of plant diseased tissue |
| material_extraction_type | resting spores |
| metadata_revision_date | 2025-02-27 |
| metadata_revision_filename | 2024-12-20_Combined_Plant_Pathogen_sample_metadata_forQCIF_removelatlong.xlsx |
| n_libraries_pooled | 1.0 |
| order | Plasmodiophorida |
| phylum | Endomyxa |
| project_lead | Maxim Prokchorchik | University of Sydney |
| sample_collection_type | University |
| sample_custodian | Maxim Prokchorchik | University of Sydney |
| sample_quality | purified spores |
| sample_type | Field isolate spores |
| scientific_name | Plasmodiophora brassicae |
| scientific_name_authorship | Woronin (1877) |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | v2 300 cycles |
| sequencing_model | MiSeq |
| sequencing_platform | Illumina |
| species | brassicae |
| specimen_custodian | Maxim Prokchorchik | University of Sydney |
| specimen_id | VIC2 |
| specimen_id_description | Maxim Prokchorchik | University of Sydney |
| state_or_region | Victoria |
| taxon_id | 37360 |
| taxonomic_group | Protist |
| ticket | BPAOPS-1592 |
| type_status | unknown |
| work_order | 20047 |