Desert Mouse, Whole Genomes, Illumina TruSeq DNA, spleen
Dataset size is: 58.21 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:archive_ingestion_date:365:omg-consortium-members |
| Access Control Date | 2020-09-16 |
| Access Control Mode | date |
| Sequence Data Type | illumina-shortread |
| access_rights | no restrictions |
| ala_specimen_url | https://biocache.ala.org.au/occurrences/a57a4ca1-380d-459d-83a3-69564542b8df |
| ancillary_notes | DNA conc method = Qubit, DNA total µg = 106.92 |
| archive_ingestion_date | 2019-09-17 |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-856/ |
| birth_date | unknown |
| bpa_dataset_id | 102.100.100/52615 |
| bpa_library_id | 102.100.100/54313 |
| bpa_sample_id | 102.100.100/41597 |
| bpa_work_order | 40047 |
| class | Mammalia |
| collection_date | 2011-07-30 |
| collection_method | elliott trap |
| collector | Kevin C Rowe |
| collector_sample_id | KCR1274 |
| common_name | Desert Mouse |
| coord_uncertainty_metres | 200.0 |
| country | Australia |
| custodian | Kevin C Rowe | Museums Victoria |
| data_custodian | Kevin C. Rowe |
| data_generated | 2019-09-17 |
| data_type | Illumian FASTQ |
| dataset_url | (ingested) |
| date_of_transfer | 2019-09-17 |
| ddrad_data | no |
| ddrad_dataset_ids | NA |
| death_date | 2011-07-30 |
| description | NovaSeq 6000- Whole Genome - 41600 and 41597 |
| dna_conc_ng_ul | 594.0 |
| dna_extracted_by | Kevin C Rowe |
| dna_extraction_date | 2019-05-15 |
| dna_extraction_method | Qiagen DNEasy |
| dna_treatment | Qiagen DNEasy Extraction |
| exon_capture_data | no |
| exon_capture_dataset_ids | NA |
| experimental_design | 1x NovaSeq 6000 150 bp paired-end reads |
| facility_sample_id | 9406-2 |
| family | Muridae |
| file | 41597_HT25VDSXX_CAAGCTAG-ACATAGCG_S1_L003_R1, 41597_HT25VDSXX_CAAGCTAG-ACATAGCG_S1_L003_R2 |
| flowcell_id | HT25VDSXX |
| folder_name | 20190912_AGRF_BPA_OMG_HT25VDSXX |
| genome_data | yes |
| genome_dataset_ids | 52615.0 |
| genus | Pseudomys |
| habitat | Spinifex desert |
| identified_by | Kevin Rowe |
| institution_name | Museums Victoria |
| latitude | -18.63133 |
| library_comments | DNA conc method = Qubit, DNA total µg = 12.96 (41596) or 106.92 (41597) |
| library_index_id | UDI0007 |
| library_index_sequence | CAAGCTAG-ACATAGCG |
| library_location | AGRF |
| library_ng_ul | 37.5 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 8.0 |
| library_prep_date | 2019-08-28 |
| library_prep_method | Illumina TruSeq DNA Nano |
| library_prepared_by | Justin Crockett |
| library_status | Sequenced |
| library_type | Illumina TruSeq DNA |
| life_stage | adult organism |
| location_text | Barkly Tableland, Brunnette Downs, Bore 45 |
| longitude | 136.25366 |
| n_libraries_pooled | 1 |
| omg_project | Whole Genomes |
| order | Rodentia |
| phylum | Chordata |
| prior_genetics | unknown |
| sample_quality | high molecular weight |
| sample_submission_date | 2019-09-17 |
| sequence_length | 150 bp PE |
| sequencing_facility | AGRF |
| sequencing_platform | NovaSeq |
| sex | male |
| software_version | Illumina RTA v3.4.4 |
| source_population | unknown |
| species | desertor |
| species_name | Pseudomys desertor |
| state_or_region | Northern Territory |
| subspecies_or_variant | NA |
| taxon_id | 221914 |
| taxonomic_group | rodent |
| ticket | BPAOPS-856 |
| tissue_collection | Mammalogy |
| tissue_number | NMV Z21333 QB |
| tissue_preservation | RNALater |
| tissue_type | spleen |
| trace_lab | no |
| type_status | unknown |
| voucher_id | NMV_C36879 |
| voucher_number | NMV C36879 |
| voucher_or_tissue_number | NMV C36879 |
| wild_captive | wild |