Grasslands PacBio-IsoSeq, Reference genomes, Sample ID 369564
Dataset size is: 15.00 GiB
This dataset is currently under a short embargo period until December 30, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members |
Access Control Date | 2025-12-30 |
Access Control Mode | date |
Sequence Data Type | pacbio-hifi |
Related Data | PacBio-IsoSeq |
analysis_software | SMRT Link Analysis 13.0.0.208615 |
base_url | https://downloads-qcif.bioplatforms.com/bpa/grasslands/pacbio-hifi/BPAOPS-1603/20240620_AG_AGRF_CAGRF24020350_m84073_240615_195929_s4/ |
bioplatforms_project | Australian Grasslands Initiative (AG) |
cell_postion | A01 |
collected_by | Rachael Gallagher |
collection_date | 2021-06-16 |
common_name | Kangaroo grass |
country | Australia |
data_context | Transcriptomics - long read |
data_type | Main dataset |
dataset_id | 102.100.100/373573 |
dataset_url | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1603 |
date_data_published | 28/06/2024 |
date_of_transfer | 2024-06-26 |
date_of_transfer_to_archive | 2024-06-27 |
decimal_latitude_public | -33.39 |
decimal_longitude_public | 151.33 |
description | PacBio-IsoSeq |
dna_treatment | NA |
experimental_design | NA |
experimental_notes | RNA tissue - embryo |
facility | AGRF |
facility_sample_id | 371793.0 |
family | Poaceae |
fast5_compression | NA |
flowcell_id | m84073_240615_195929_s4 |
flowcell_type | SMRT Cell 25M |
folder_name | 20240620_AG_AGRF_CAGRF24020350_m84073_240615_195929_s4 |
growth_facility | Macquarie University Plant Growth facility |
id_vetting_by | Karen |
initiative_prefix | Grasslands |
insert_size_range | NA |
latitude | -33.39 |
library_comments | NA |
library_construction_protocol | Preparing Kinnex libraries using the Kinnex full-length RNA kit |
library_id | 102.100.100/371793 |
library_index_id | IsoSeqX_bc11_5p |
library_index_id_dual | NA |
library_index_seq | CTACACGACGCTCTTCCGATCTGTAGATAGCAATGAAGTCGCAGGGTTGGG |
library_index_seq_dual | NA |
library_layout | NA |
library_location | AGRF |
library_ng_ul | 4.9 |
library_oligo_sequence | NA |
library_oligo_sequence_dual | NA |
library_pcr_cycles | 10 |
library_pcr_reps | 1 |
library_prep_date | 2024-06-02 |
library_prepared_by | Trent Peters |
library_selection | NA |
library_source | RNA |
library_strategy | RNAseq |
library_type | PacBio-IsoSeq |
location_id | Narara |
longitude | 151.33 |
metadata_revision_date | 2024-12-16 |
metadata_revision_filename | Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx |
model_base_caller | NA |
movie_length | 30Hrs |
n_libraries_pooled | 6 |
plant_growth_medium | Standard MQ loam |
ploidy | 2n |
preservation_date_begin | 2024-04-24 |
preservation_storage_location | Western Sydney University |
preservation_temperature | -80°C |
project_aim | Reference genomes |
sample_id | 102.100.100/369564 |
sample_material_associated_references | Bioline-BIO-52073 |
sample_material_preparation_date | 2024-04-24 |
sample_material_preparation_process | BIO-52073 RNA extraction kit |
sample_material_preparation_type | RNA |
sample_material_prepared_by | Brian Atwell | Vinod Jacob | Lily Chen | Western Sydney University |
sample_replicate | NA |
scientific_name | Themeda triandra |
scientific_name_authorship | Forssk |
sequencing_facility | AGRF |
sequencing_kit_chemistry_version | Revio sequencing plate |
sequencing_model | PacBio Revio |
sequencing_platform | PACBIO_SMRT |
state_or_territory | NSW |
taxon_id | 106636 |
team_lead_email | brian.atwell@mq.edu.au |
team_lead_name | Brian Atwell |
ticket | BPAOPS-1603 |