Grasslands Illumina ddRAD-seq, Genotyping, Dataset ID 373572

Kangaroo grass, Themeda triandra, Poaceae, Location ID Sydney, Brian Atwell

Dataset size is: 158.98 GiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members
Access Control Date 2025-10-28
Access Control Mode date
Sequence Data Type illumina-ddrad
accession_number_seed ?
base_url https://downloads-qcif.bioplatforms.com/bpa/grasslands/ddrad/BPAOPS-1711/20241023_AG_AGRF_22NTCKLT3/
bioplatforms_dataset_id 102.100.100/373572
bioplatforms_project Australian Grasslands Initiative (AG)
bpa_dataset_id 102.100.100/373572
collected_by Brian Atwell
common_name Kangaroo grass
country Australia
data_context Genomics - genotyping
data_type ddRAD
dataset_url https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1711
date_of_transfer 2024-10-28
date_of_transfer_to_archive 2024-10-29
decimal_latitude_public -33.68810173
decimal_longitude_public 151.0624105
description Illumina ddRAD-seq
experimental_design PstI/HpyCH4IV
experimental_notes Replicate-j
facility_project_code CAGRF23120086-1
family Poaceae
flowcell_id 22NTCKLT3
flowcell_type 10B
folder_name 20241023_AG_AGRF_22NTCKLT3
growth_condition Low_Temperature
growth_facility Macquarie University Glasshouses
insert_size_range 280-375 bp
latitude -33.68810173
library_construction_protocol ddRAD (based on Peterson et al 2012)
library_layout paired end
library_location AGRF_Perth
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G
library_pcr_cycles 11.0
library_pcr_reps 7.0
library_prep_date 2024-10-07
library_prepared_by Jeremy Beerkens
library_selection Restriction Digest
library_source GENOMIC
library_strategy RAD-Seq
library_type ddRAD
location_id Sydney
longitude 151.0624105
metadata_revision_date 2024-12-16
metadata_revision_filename Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx
n_libraries_pooled 3.0
plant_developmental_stage Vegetative
plant_growth_medium Soil & Potting Mix
plant_structure Tussock Grass
preservation_date_begin 2023-12-12
preservation_storage_location University of Tasmania
preservation_temperature -80°C
preservation_type Stored in nuclease free water
project_aim Genotyping
sample_id 102.100.100/369658
sample_material_preparation_date 2023-12-12
sample_material_preparation_process CTAB extraction with RNAse treatment
sample_material_preparation_type DNA
sample_material_prepared_by Jazmine Humphreys | Vinod Jacob | Alejandro Correa Lozano | University of Tasmania
sample_replicate 4.0
scientific_name Themeda triandra
scientific_name_authorship Forssk
sequencing_facility AGRF_Melbourne
sequencing_model NovaSeq X Plus
sequencing_platform ILLUMINA
state_or_territory NSW
taxon_id 106636
team_lead_email brian.atwell@mq.edu.au
team_lead_name Brian Atwell
ticket BPAOPS-1711