Grasslands Illumina ddRAD-seq, Genotyping, Dataset ID 373572
Dataset size is: 158.98 GiB
This dataset is currently under a short embargo period until October 28, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
373572_AG_AGRF_22NTCKLT3_GTGAAA_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_ACAGTG_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_CTTGTA_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_GTGAAA_... Metadata Only FASTQ
-
373572_AG_AGRF_22NTCKLT3_ACAGTG_... Metadata Only FASTQ
-
AG_CAGRF23120086_22NTCKLT3_Metadata.xlsx Metadata Only XLSX
-
373572_AG_AGRF_22NTCKLT3_CTTGTA_... Metadata Only FASTQ
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:grassland-consortium-members |
Access Control Date | 2025-10-28 |
Access Control Mode | date |
Sequence Data Type | illumina-ddrad |
accession_number_seed | ? |
base_url | https://downloads-qcif.bioplatforms.com/bpa/grasslands/ddrad/BPAOPS-1711/20241023_AG_AGRF_22NTCKLT3/ |
bioplatforms_dataset_id | 102.100.100/373572 |
bioplatforms_project | Australian Grasslands Initiative (AG) |
bpa_dataset_id | 102.100.100/373572 |
collected_by | Brian Atwell |
common_name | Kangaroo grass |
country | Australia |
data_context | Genomics - genotyping |
data_type | ddRAD |
dataset_url | https://data.bioplatforms.com/dataset?ext_search_by=&q=ticket%3ABPAOPS-1711 |
date_of_transfer | 2024-10-28 |
date_of_transfer_to_archive | 2024-10-29 |
decimal_latitude_public | -33.68810173 |
decimal_longitude_public | 151.0624105 |
description | Illumina ddRAD-seq |
experimental_design | PstI/HpyCH4IV |
experimental_notes | Replicate-j |
facility_project_code | CAGRF23120086-1 |
family | Poaceae |
flowcell_id | 22NTCKLT3 |
flowcell_type | 10B |
folder_name | 20241023_AG_AGRF_22NTCKLT3 |
growth_condition | Low_Temperature |
growth_facility | Macquarie University Glasshouses |
insert_size_range | 280-375 bp |
latitude | -33.68810173 |
library_construction_protocol | ddRAD (based on Peterson et al 2012) |
library_layout | paired end |
library_location | AGRF_Perth |
library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
library_pcr_cycles | 11.0 |
library_pcr_reps | 7.0 |
library_prep_date | 2024-10-07 |
library_prepared_by | Jeremy Beerkens |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | RAD-Seq |
library_type | ddRAD |
location_id | Sydney |
longitude | 151.0624105 |
metadata_revision_date | 2024-12-16 |
metadata_revision_filename | Australian_grasslands_metadata_combined_2024-12-12_forQCIF.xlsx |
n_libraries_pooled | 3.0 |
plant_developmental_stage | Vegetative |
plant_growth_medium | Soil & Potting Mix |
plant_structure | Tussock Grass |
preservation_date_begin | 2023-12-12 |
preservation_storage_location | University of Tasmania |
preservation_temperature | -80°C |
preservation_type | Stored in nuclease free water |
project_aim | Genotyping |
sample_id | 102.100.100/369658 |
sample_material_preparation_date | 2023-12-12 |
sample_material_preparation_process | CTAB extraction with RNAse treatment |
sample_material_preparation_type | DNA |
sample_material_prepared_by | Jazmine Humphreys | Vinod Jacob | Alejandro Correa Lozano | University of Tasmania |
sample_replicate | 4.0 |
scientific_name | Themeda triandra |
scientific_name_authorship | Forssk |
sequencing_facility | AGRF_Melbourne |
sequencing_model | NovaSeq X Plus |
sequencing_platform | ILLUMINA |
state_or_territory | NSW |
taxon_id | 106636 |
team_lead_email | brian.atwell@mq.edu.au |
team_lead_name | Brian Atwell |
ticket | BPAOPS-1711 |