Black Fungus, black bread mould, reference genome, ONT-PromethION, Nasal soft tissue
Dataset size is: 681.20 GiB
This dataset is currently under a short embargo period until February 26, 2026 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
FUN_BRF_PBA04981_ONTPromethION_r... Metadata Only HTML
-
466448_FUN_BRF_PBA04981_ONTProme... Metadata Only TAR
-
FUN_BRF_PBA04981_ONTPromethION_b... Metadata Only
-
FUN_BRF_PBA04981_metadata.xlsx Metadata Only XLSX
-
466448_FUN_BRF_PBA04981_ONTProme... Metadata Only TAR
-
FUN_BRF_PBA04981_ONTPromethION_pod5.tar Metadata Only TAR
Optional
-
FUN_BRF_PBA04981_ONTPromethION_s... Metadata Only
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:fungi-consortium-members |
| Access Control Date | 2026-02-26 |
| Access Control Mode | date |
| Sequence Data Type | ont-promethion |
| altitude | NA |
| analysis_software | MinKNOW 24.11.11 |
| ancillary_notes | NA |
| associated_media | None |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/fungi_staging/ont-promethion/BPAOPS-1762/20250218_FUN_BRF_PBA04981/ |
| bioplatforms_dataset_id | 102.100.100/467801 |
| bioplatforms_library_id | 102.100.100/466448 |
| bioplatforms_project | Australian Functional Fungi Initiative |
| bioplatforms_sample_id | 102.100.100/464448 |
| ccg_jira_ticket | BPAOPS-1762 |
| cell_postion | 3E |
| class | Mucoromycetes |
| collection_date | 2021-06-01 |
| collection_method | Culturing on Potato Dextrose Broth |
| collection_permit | Institutional Biosafety Committee (IBC) |
| collector | Caterina Selva |
| collector_sample_id | CLIN_002 |
| common_name | Black Fungus, black bread mould |
| country | Australia |
| data_context | reference genome |
| data_type | ONT-promethion |
| date_of_transfer | 2025-02-26 |
| date_of_transfer_to_archive | 2025-02-28 |
| decimal_latitude_public | NA |
| decimal_longitude_public | NA |
| depth | NA |
| dna_treatment | Blue pippin 15 Kb size selection |
| env_broad_scale | NA |
| env_local_scale | NA |
| env_medium | NA |
| experimental_design | ONT long reads |
| facility_project_code | NA |
| facility_sample_id | 864-3 |
| family | Mucoraceae |
| fast5_compression | pod5 bvz |
| flow_cell_id | PBA04981 |
| flowcell_id | PBA04981 |
| flowcell_type | FLO-PRO114M |
| folder_name | /20250218_FUN_BRF_PBA04981 |
| genus | Rhizopus |
| habitat | Infected human |
| health_state | Healthy |
| host_common_name | Human |
| host_family | Hominidae |
| host_organ | Respiratory system |
| host_scientific_name | Homo sapiens |
| host_status | Infected human |
| host_symptom | NA |
| identified_by | Caterina Selva, Flinders University |
| indigenous_location | Kaurna |
| insert_size_range | 30 Kbp |
| isolate | Clinical isolate |
| library_construction_protocol | Native barcoded ligation libraries with NBD114 |
| library_id | 466448 |
| library_index_id | barcode18 |
| library_index_seq | CCAAACCCAACAACCTAGATAGGC |
| library_layout | NA |
| library_location | BRF labs |
| library_ng_ul | 8.06 |
| library_oligo_sequence | 5' - AAGGTTAA - barcode - CAGCACCT - 3' |
| library_prep_date | 2025-02-19 |
| library_prepared_by | Carolina Correa-Ospina |
| library_selection | random |
| library_source | genomic |
| library_strategy | WGS |
| library_type | ONT-PromethION |
| life_stage | NA |
| location_info_restricted | no |
| location_text | Obtained from SA Pathology |
| material_conc_ng_ul | 100.0 |
| material_extracted_by | Caterina Selva |
| material_extraction_date | 2024-07-11 |
| material_extraction_method | Phenol chloroform |
| material_extraction_type | gDNA |
| metadata_revision_date | 2024-11-12 |
| metadata_revision_filename | FUN_MASTER_sample_metadata_FORDP_20241111_NOLATLON.xlsx |
| model_base_caller | Super-accurate basecalling v4.3.0, 400 bps |
| movie_length | 76h |
| n_libraries_pooled | 3.0 |
| order | Mucorales |
| phylum | Mucoromycota |
| project_lead | Caterina Selva |
| sample_collection_type | living organism |
| sample_custodian | Caterina Selva |
| sample_id | CLIN_002_Mycelia_DNA |
| sample_id_description | Personal, created by Caterina Selva |
| sample_quality | Absorbance ratios A260/280 and A260/230 within AGRF reccommendations |
| sample_type | tissue sample |
| scientific_name | Rhizopus arrhizus |
| scientific_name_authorship | Fischer, 1892 |
| scientific_name_note | Many taxonomic synonyms. For example, R. oryzae and R. delemar |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | SQK-NBD114.24 |
| sequencing_model | ONT PromethION |
| sequencing_platform | Oxford Nanopore |
| source_population | NA |
| species | arrhizus |
| specimen_custodian | Caterina Selva, Flinders University |
| specimen_id | CLIN_002 |
| specimen_id_description | Personal, created by Caterina Selva |
| state_or_region | South Australia |
| sub_species | NA |
| taxon_id | 64495.0 |
| taxonomic_group | Fungi |
| temperature | NA |
| ticket | BPAOPS-1762 |
| tissue | Nasal soft tissue |
| tissue_preservation | Nucleic acid in MQ water, stored at -20C |
| tissue_preservation_temperature | -20.0 |
| type_status | NA |
| wild_captive | None, isolated from infected human |
| work_order | 21003.0 |