Reference genome, Illumina-HiC
Dataset size is: 92.20 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:aus-avian-consortium-members |
| Access Control Date | 2025-02-09 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| analysis_software | DRAGEN BCLConvert |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/avian_staging/genomics-hi-c/BPAOPS-1747/ |
| bioplatforms_dataset_id | 102.100.100/613515 |
| bioplatforms_library_id | 102.100.100/611527 |
| bioplatforms_project | Australian Avian Genomics Initiative (AVIAN) |
| bioplatforms_sample_id | 102.100.100/609527 |
| ccg_jira_ticket | BPAOPS-1747 |
| data_context | Reference genome |
| data_type | Illumina-HiC |
| date_of_transfer | 2024-02-10 |
| date_of_transfer_to_archive | 2025-02-14 |
| dna_treatment | FA crosslinking |
| experimental_design | 4.1.23 |
| facility_project_code | NA |
| facility_sample_id | 611527_AVIAN_BRF_22KYTHLT4_TGGTGAAG |
| flowcell_id | 22KYTHLT4 |
| flowcell_type | NovaSeq X 25B |
| folder_name | 20250210_AVIAN_BRF_613515_22KYTHLT4 |
| insert_size_range | ~600bp |
| library_construction_protocol | HiC Arima 2.0 |
| library_id | 611527 |
| library_index_id | NEB_Set1_D12 |
| library_index_seq | TGGTGAAG |
| library_layout | Paired end |
| library_location | BRF Freezer |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGTGAAG(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction digest |
| library_source | GENOMIC |
| library_strategy | HiC |
| library_type | Illumina-HiC |
| n_libraries_pooled | 1 |
| project_collaborators | Rhiannon Schembri |
| project_lead | Simon Griffith |
| sample_id | MSF_W471.02 |
| scientific_name | Poephila personata |
| sequencing_facility | BRF |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| specimen_id | MSF_W471 |
| ticket | BPAOPS-1747 |
| work_order | 26003 |