Phylogenomics, Illumina-shortread, tail tip
Dataset size is: 206.97 MiB
This dataset is currently under a short embargo period until January 23, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-01-23 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | not included in metadata |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
| bioplatforms_dataset_id | 102.100.100/351835 |
| bioplatforms_library_id | 102.100.100/455371 |
| bioplatforms_sample_id | 102.100.100/453890 |
| certainty | NA |
| class | Reptilia |
| collection_method | unknown |
| collector | Craig Moritz |
| collector_sample_id | NA |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Craig Moritz |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351835 |
| date_of_transfer | 2024-01-24 |
| date_of_transfer_to_archive | 2024-02-08 |
| decimal_latitude_public | -16.5945 |
| decimal_longitude_public | 145.3398 |
| description | Short reads |
| dna_treatment | Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 455371_AusARG_BRF_HWWNTDRX3_GAACCTCAGT |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HWWNTDRX3 |
| flowcell_type | Novaseq S1 |
| folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
| genotypic_sex | not determined |
| genus | Lampropholis |
| habitat | unknown |
| identified_by | Craig Moritz |
| insert_size_range | 150bp PE |
| institution_name | Australian National University |
| latitude | -16.5945 |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455371 |
| library_index_id | p7_UDI_0695 |
| library_index_id_dual | p5_UDI_0695 |
| library_index_seq | GAACCTCAGT |
| library_index_seq_dual | AAGAGACCTC |
| library_layout | paired end |
| library_location | EBL Freezers |
| library_ng_ul | 4.3426165064 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAACCTCAGTATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACAAGAGACCTCACACTCTTTCCCTACACGACGCTCTTCCGATC |
| library_pcr_cycles | 8 |
| library_pcr_reps | 2 |
| library_prep_date | 2023-11-01 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | SqCL2/Exon Capture |
| lifestage | unknown |
| location_text | Near base of Mount Lewis |
| longitude | 145.3398 |
| material_conc_ng_ul | 31.215 |
| material_extracted_by | Rhiannon Schembri |
| material_extraction_date | 2023-04-20 |
| material_extraction_method | Macherey-Nagel Plate Extraction Kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-01-25 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 305 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Craig Moritz |
| sample_id | 102.100.100/453890 |
| sample_quality | unknown |
| scientific_name | Lampropholis coggeri |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | coggeri |
| specimen_id | SEW4379 |
| specimen_id_description | Australian National University |
| state_or_region | Queensland |
| subspecies | NA |
| taxon_id | 260890 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1556 |
| tissue_collection | Stephen Zozaya Collection |
| tissue_number | SE W4379 |
| tissue_preservation | RNAlater |
| tissue_type | tail tip |
| type_status | NA |
| voucher_or_tissue_number | SE W4379 |
| wild_captive | wild |
| work_order | 13077 |