Tussock Skink, Phylogenomics, Illumina-shortread, liver
Dataset size is: 132.87 MiB
This dataset is currently under a short embargo period until January 23, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2025-01-23 |
Access Control Mode | date |
Sequence Data Type | Illumina-shortread |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
bioplatforms_dataset_id | 102.100.100/351835 |
bioplatforms_library_id | 102.100.100/455370 |
bioplatforms_sample_id | 102.100.100/453889 |
certainty | NA |
class | Reptilia |
collection_date | 1991-12-10 |
collection_method | unknown |
collector | Steve Donnellan |
collector_sample_id | NA |
common_name | Tussock Skink |
country | Australia |
data_context | Phylogenomics |
data_custodian | Craig Moritz |
data_type | Illumina-shortread |
dataset_id | 102.100.100/351835 |
date_of_transfer | 2024-01-24 |
date_of_transfer_to_archive | 2024-02-08 |
decimal_latitude_public | -30.13 |
decimal_longitude_public | 151.63 |
description | Short reads |
dna_treatment | Bioruptor cycles |
experimental_design | Capture probes |
facility | BRF |
facility_project_code | BRF |
facility_sample_id | 455370_AusARG_BRF_HWWNTDRX3_ATGGAAGTAA |
family | Scincidae |
file_type | FASTQ |
flowcell_id | HWWNTDRX3 |
flowcell_type | Novaseq S1 |
folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
genotypic_sex | not determined |
genus | Pseudemoia |
habitat | unknown |
identified_by | Steve Donnellan |
insert_size_range | 150bp PE |
institution_name | South Australian Museum |
latitude | -30.13 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/455370 |
library_index_id | p7_UDI_0694 |
library_index_id_dual | p5_UDI_0694 |
library_index_seq | ATGGAAGTAA |
library_index_seq_dual | TCATGAGATG |
library_layout | paired end |
library_location | EBL Freezers |
library_ng_ul | 30.7866281853 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGGAAGTAAATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACTCATGAGATGACACTCTTTCCCTACACGACGCTCTTCCGATC |
library_pcr_cycles | 8 |
library_pcr_reps | 2 |
library_prep_date | 2023-11-01 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | SqCL2/Exon Capture |
lifestage | unknown |
location_text | Glenshiel RD, 5 KM W of New England HW,N Guyra |
longitude | 151.63 |
material_conc_ng_ul | 20.256 |
material_extracted_by | Rhiannon Schembri |
material_extraction_date | 2023-04-20 |
material_extraction_method | Macherey-Nagel Plate Extraction Kit |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 305 |
order | Squamata |
phenotypic_sex | female |
phylum | Chordata |
prior_genetics | NA |
sample_custodian | Sally South |
sample_id | 102.100.100/453889 |
sample_quality | unknown |
scientific_name | Pseudemoia cf pagenstecheri |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | cf pagenstecheri |
specimen_id | SAMA R39106 |
specimen_id_description | South Australian Museum |
state_or_region | New South Wales |
subspecies | A |
taxon_id | 394167 |
taxonomic_group | Squamata |
ticket | BPAOPS-1556 |
tissue_collection | Australian Biological Tissue Collection |
tissue_number | ABTC12428 |
tissue_preservation | frozen |
tissue_type | liver |
type_status | NA |
voucher_or_tissue_number | SAMA R39106 |
wild_captive | wild |
work_order | 13077 |