Phylogenomics, Illumina-shortread, unknown
Dataset size is: 281.93 MiB
This dataset is currently under a short embargo period until January 23, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-01-23 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
| bioplatforms_dataset_id | 102.100.100/351835 |
| bioplatforms_library_id | 102.100.100/455368 |
| bioplatforms_sample_id | 102.100.100/453887 |
| certainty | NA |
| class | Reptilia |
| collection_method | unknown |
| collector | unknown |
| collector_sample_id | NA |
| country | unknown |
| data_context | Phylogenomics |
| data_custodian | Craig Moritz |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351835 |
| date_of_transfer | 2024-01-24 |
| date_of_transfer_to_archive | 2024-02-08 |
| description | Short reads |
| dna_treatment | Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 455368_AusARG_BRF_HWWNTDRX3_ATAGCTGTCG |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HWWNTDRX3 |
| flowcell_type | Novaseq S1 |
| folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
| genotypic_sex | not determined |
| genus | Menetia |
| habitat | unknown |
| identified_by | unknown |
| insert_size_range | 150bp PE |
| institution_name | South Australian Museum |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455368 |
| library_index_id | p7_UDI_0692 |
| library_index_id_dual | p5_UDI_0692 |
| library_index_seq | ATAGCTGTCG |
| library_index_seq_dual | GCTGTTCGTT |
| library_layout | paired end |
| library_location | EBL Freezers |
| library_ng_ul | 16.9995808708 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACATAGCTGTCGATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACGCTGTTCGTTACACTCTTTCCCTACACGACGCTCTTCCGATC |
| library_pcr_cycles | 8 |
| library_pcr_reps | 2 |
| library_prep_date | 2023-11-01 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | SqCL2/Exon Capture |
| lifestage | unknown |
| location_text | unknown |
| material_conc_ng_ul | 45.186 |
| material_extracted_by | Rhiannon Schembri |
| material_extraction_date | 2023-04-20 |
| material_extraction_method | Macherey-Nagel Plate Extraction Kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-01-25 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 305 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Sally South |
| sample_id | 102.100.100/453887 |
| sample_quality | unknown |
| scientific_name | Menetia alanae (W) |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | alanae (W) |
| specimen_id | ABTC79079 |
| specimen_id_description | South Australian Museum |
| state_or_region | unknown |
| subspecies | alanae (W) |
| taxon_id | 243801 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1556 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC79079 |
| tissue_preservation | unknown |
| tissue_type | unknown |
| type_status | NA |
| voucher_or_tissue_number | ABTC79079 |
| wild_captive | wild |
| work_order | 13077 |