Brown Bicarinate Rainbow-skink, Phylogenomics, Illumina-shortread, liver
Dataset size is: 684.22 MiB
This dataset is currently under a short embargo period until January 23, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-01-23 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
| bioplatforms_dataset_id | 102.100.100/351835 |
| bioplatforms_library_id | 102.100.100/455363 |
| bioplatforms_sample_id | 102.100.100/453882 |
| certainty | NA |
| class | Reptilia |
| collection_date | 2001-05-03 |
| collection_method | unknown |
| collector | Mark Hutchinson | M Sacci | G Armstrong |
| collector_sample_id | NA |
| common_name | Brown Bicarinate Rainbow-skink |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Craig Moritz |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351835 |
| date_of_transfer | 2024-01-24 |
| date_of_transfer_to_archive | 2024-02-08 |
| decimal_latitude_public | -16.9333 |
| decimal_longitude_public | 145.7667 |
| description | Short reads |
| dna_treatment | Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 455363_AusARG_BRF_HWWNTDRX3_ATCTCCGTAC |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HWWNTDRX3 |
| flowcell_type | Novaseq S1 |
| folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
| genotypic_sex | not determined |
| genus | Carlia |
| habitat | unknown |
| identified_by | Mark Hutchinson |
| insert_size_range | 150bp PE |
| institution_name | South Australian Museum |
| latitude | -16.9333 |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455363 |
| library_index_id | p7_UDI_0687 |
| library_index_id_dual | p5_UDI_0687 |
| library_index_seq | ATCTCCGTAC |
| library_index_seq_dual | ACGGTTCATT |
| library_layout | paired end |
| library_location | EBL Freezers |
| library_ng_ul | 4.6087635307 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTCCGTACATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACACGGTTCATTACACTCTTTCCCTACACGACGCTCTTCCGATC |
| library_pcr_cycles | 8 |
| library_pcr_reps | 2 |
| library_prep_date | 2023-11-01 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | SqCL2/Exon Capture |
| lifestage | unknown |
| location_text | Cairns, N side of Lily Creek, just N of James St |
| longitude | 145.7667 |
| material_conc_ng_ul | 18.343 |
| material_extracted_by | Rhiannon Schembri |
| material_extraction_date | 2023-04-20 |
| material_extraction_method | Macherey-Nagel Plate Extraction Kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-01-25 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 305 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Sally South |
| sample_id | 102.100.100/453882 |
| sample_quality | unknown |
| scientific_name | Carlia storri |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | storri |
| specimen_id | SAMA R55865 |
| specimen_id_description | South Australian Museum |
| state_or_region | Queensland |
| subspecies | NA |
| taxon_id | 124119 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1556 |
| tissue_collection | Australian Biological Tissue Collection |
| tissue_number | ABTC77184 |
| tissue_preservation | frozen |
| tissue_type | liver |
| type_status | NA |
| voucher_or_tissue_number | SAMA R55865 |
| wild_captive | wild |
| work_order | 13077 |