Exquisite Firetail Skink, Phylogenomics, Illumina-shortread, unknown
Dataset size is: 446.97 MiB
This dataset is currently under a short embargo period until January 23, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-01-23 |
| Access Control Mode | date |
| Sequence Data Type | Illumina-shortread |
| access_rights | No restrictions |
| ala_specimen_url | NA |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
| bioplatforms_dataset_id | 102.100.100/351835 |
| bioplatforms_library_id | 102.100.100/455347 |
| bioplatforms_sample_id | 102.100.100/453866 |
| certainty | NA |
| class | Reptilia |
| collection_date | 2016-06-01 |
| collection_method | pitfall trap |
| collector | I G Bren | R D Bray | P Doughty |
| collector_sample_id | NA |
| common_name | Exquisite Firetail Skink |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Craig Moritz |
| data_type | Illumina-shortread |
| dataset_id | 102.100.100/351835 |
| date_of_transfer | 2024-01-24 |
| date_of_transfer_to_archive | 2024-02-08 |
| description | Short reads |
| dna_treatment | 7 Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| facility_project_code | BRF |
| facility_sample_id | 455347_AusARG_BRF_HWWNTDRX3_GTTGACGTCG |
| family | Scincidae |
| file_type | FASTQ |
| flowcell_id | HWWNTDRX3 |
| flowcell_type | Novaseq S1 |
| folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
| genotypic_sex | not determined |
| genus | Morethia |
| habitat | Sandy, rocky creek bed at based of large rocks |
| identified_by | Paul Doughty |
| insert_size_range | 150bp PE |
| institution_name | Western Australian Museum |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455347 |
| library_index_id | p7_UDI_1332 |
| library_index_id_dual | p5_UDI_1332 |
| library_index_seq | GTTGACGTCG |
| library_index_seq_dual | ACTCCTTTGG |
| library_layout | paired end |
| library_location | EBL Freezers |
| library_ng_ul | 9.0425051008 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTGACGTCGATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACACTCCTTTGGACACTCTTTCCCTACACGACGCTCTTCCGATC |
| library_pcr_cycles | 8 |
| library_pcr_reps | 2 |
| library_prep_date | 2023-11-01 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | SqCL2/Exon Capture |
| lifestage | unknown |
| location_text | Warrawagine Station, 34km NNW Warrawagine homestead |
| material_conc_ng_ul | 26.5 |
| material_extracted_by | Rhiannon Schrembri |
| material_extraction_date | 2023-04-20 |
| material_extraction_method | Macherey-Nagel Silica Plate extraction kit |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-01-25 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
| method_of_determination | NA |
| n_libraries_pooled | 305 |
| order | Squamata |
| phenotypic_sex | not determined |
| phylum | Chordata |
| prior_genetics | NA |
| sample_custodian | Paul Doughty |
| sample_id | 102.100.100/453866 |
| sample_quality | unknown |
| scientific_name | Morethia ruficauda |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq 6000 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | ruficauda |
| specimen_id | WAM R175412 |
| specimen_id_description | Western Australian Museum |
| state_or_region | Western Australia |
| subspecies | exquisita |
| taxon_id | 394149 |
| taxonomic_group | Squamata |
| ticket | BPAOPS-1556 |
| tissue_collection | Herpetology |
| tissue_number | WAM R175412 |
| tissue_preservation | unknown |
| tissue_type | unknown |
| type_status | NA |
| voucher_or_tissue_number | WAM R175412 |
| wild_captive | wild |
| work_order | 13077 |