Lined Firetail Skink, Phylogenomics, Illumina-shortread, unknown
Dataset size is: 997.30 MiB
This dataset is currently under a short embargo period until January 23, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2025-01-23 |
Access Control Mode | date |
Sequence Data Type | Illumina-shortread |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/illumina-fastq/BPAOPS-1556/20240124_AusARG_BRF_351835_HWWNTDRX3/ |
bioplatforms_dataset_id | 102.100.100/351835 |
bioplatforms_library_id | 102.100.100/455346 |
bioplatforms_sample_id | 102.100.100/453865 |
certainty | NA |
class | Reptilia |
collection_date | 2009-05-21 |
collection_method | funnel trap |
collector | R Palmer |
collector_sample_id | NA |
common_name | Lined Firetail Skink |
country | Australia |
data_context | Phylogenomics |
data_custodian | Craig Moritz |
data_type | Illumina-shortread |
dataset_id | 102.100.100/351835 |
date_of_transfer | 2024-01-24 |
date_of_transfer_to_archive | 2024-02-08 |
decimal_latitude_public | -15.949444 |
decimal_longitude_public | 124.559444 |
description | Short reads |
dna_treatment | 7 Bioruptor cycles |
experimental_design | Capture probes |
facility | BRF |
facility_project_code | BRF |
facility_sample_id | 455346_AusARG_BRF_HWWNTDRX3_TTTCCCAATT |
family | Scincidae |
file_type | FASTQ |
flowcell_id | HWWNTDRX3 |
flowcell_type | Novaseq S1 |
folder_name | 20240124_AusARG_BRF_351835_HWWNTDRX3 |
genotypic_sex | not determined |
genus | Morethia |
habitat | unknown |
identified_by | R Palmer |
insert_size_range | 150bp PE |
institution_name | Western Australian Museum |
latitude | -15.949444 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/455346 |
library_index_id | p7_UDI_1331 |
library_index_id_dual | p5_UDI_1331 |
library_index_seq | TTTCCCAATT |
library_index_seq_dual | AAACGTACGA |
library_layout | paired end |
library_location | EBL Freezers |
library_ng_ul | 18.8602935908 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTTCCCAATTATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACAAACGTACGAACACTCTTTCCCTACACGACGCTCTTCCGATC |
library_pcr_cycles | 8 |
library_pcr_reps | 2 |
library_prep_date | 2023-11-01 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | SqCL2/Exon Capture |
lifestage | unknown |
location_text | Storr Island, Buccaneer Archipelago |
longitude | 124.559444 |
material_conc_ng_ul | 32.6 |
material_extracted_by | Rhiannon Schrembri |
material_extraction_date | 2023-04-20 |
material_extraction_method | Macherey-Nagel Silica Plate extraction kit |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 305 |
order | Squamata |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | NA |
sample_custodian | Paul Doughty |
sample_id | 102.100.100/453865 |
sample_quality | unknown |
scientific_name | Morethia ruficauda |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | ruficauda |
specimen_id | WAM R171852 |
specimen_id_description | Western Australian Museum |
state_or_region | Western Australia |
subspecies | ruficauda |
taxon_id | 394149 |
taxonomic_group | Squamata |
ticket | BPAOPS-1556 |
tissue_collection | Herpetology |
tissue_number | WAM R171852 |
tissue_preservation | unknown |
tissue_type | unknown |
type_status | NA |
voucher_or_tissue_number | WAM R171852 |
wild_captive | wild |
work_order | 13077 |