Northern Spotted Rock Dtella, Reference genome, Illumina-HiC, tail muscle
Dataset size is: 584.37 GiB
Data and Resources
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
-
456755_AusARG_BRF_222VJYLT4_AAGT... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
Access Control Date | 2023-12-29 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | no restriction |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | nana1 lineage |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1538/20231215_AusARG_BRF_222VJYLT4/20231215_AusARG_BRF_351911_222VJYLT4/ |
bioplatforms_dataset_id | multiple (11x) |
bioplatforms_library_id | multiple (11x) |
bioplatforms_sample_id | multiple (11x) |
certainty | high |
class | Reptilia |
collection_date | 2021-06-11 |
collection_method | Captured by hand |
collector | Stephen Zozaya | Leonardo Tedeschi | Jéssica Fenker | Octavio Jiménez Robles |
collector_sample_id | CCM8043 |
common_name | Northern Spotted Rock Dtella |
country | Australia |
data_context | Reference genome |
data_custodian | Emily Roycroft |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351911 |
date_of_transfer | 2023-12-19 |
date_of_transfer_to_archive | 2023-12-22 |
decimal_latitude_public | -17.9011 |
decimal_longitude_public | 127.8321 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456755_AusARG_BRF_222VJYLT4_AAGTGTCT |
family | Gekkonidae |
file_type | fastq.gz |
flowcell_id | 222VJYLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20231215_AusARG_BRF_222VJYLT4 |
genotypic_sex | female |
genus | Gehyra |
identified_by | Stephen Zozaya |
insert_size_range | ~900bp |
institution_name | Australian National University |
latitude | -17.9011 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456755 |
library_index_id | index_8 |
library_index_seq | AAGTGTCT |
library_layout | paierd-end |
library_location | Freezer at BRF |
library_ng_ul | 3.61 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGTGTCT(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-11-23 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | adult |
location_text | Great Northern Hwy, ~40km NE Halls Creek |
longitude | 127.8321 |
material_conc_ng_ul | NA |
material_extracted_by | BRF ANU |
material_extraction_method | NA |
material_extraction_type | DNA |
metadata_revision_date | 2024-11-15 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
method_of_determination | external and internal morphology |
n_libraries_pooled | 11 |
order | Squamata |
phenotypic_sex | female |
phylum | Chordata |
prior_genetics | NA |
project_aim | Reference genome |
sample_custodian | Craig Moritz |
sample_id | 102.100.100/458265 |
sample_quality | high |
scientific_name | Common eastern froglet (Crinia signifera), Eungella Leaf-tailed Gecko (Phyllurus nephtys), Southern ornate nursery frog (Cophixalus australis), Gehyra sp. x8 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq X series 25B 300 cycles |
sequencing_model | Illumina NovaSeq X |
sequencing_platform | ILLUMINA |
source_population | NA |
species | nana |
specimen_id | CCM8043 |
specimen_id_description | ANU tissue collection |
state_or_region | Western Australia |
subspecies | NA |
taxon_id | 747211 |
taxonomic_group | lizard |
ticket | BPAOPS-1538 |
tissue_collection | Moritz Lab ANU |
tissue_number | CCM8043 |
tissue_preservation | frozen -80 |
tissue_type | tail muscle |
type_status | no |
voucher_or_tissue_number | CCM8043 |
wild_captive | wild |
work_order | 13072 |