Plain Tree Dtella, Reference genome, Illumina-HiC, tail muscle
Dataset size is: 258.35 GiB
This dataset is currently under a short embargo period until December 18, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
-
456752_AusARG_BRF_222VJYLT4_TCAG... Metadata Only FASTQ
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-12-18 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | no restriction |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1538/20231215_AusARG_BRF_222VJYLT4/20231215_AusARG_BRF_351908_222VJYLT4/ |
bioplatforms_dataset_id | multiple (11x) |
bioplatforms_library_id | multiple (11x) |
bioplatforms_sample_id | multiple (11x) |
certainty | high |
class | Reptilia |
collection_date | 2021-06-12 |
collection_method | Captured by hand |
collector | Stephen Zozaya | Leonardo Tedeschi | Jéssica Fenker | Octavio Jiménez Robles |
collector_sample_id | CCM8051 |
common_name | Plain Tree Dtella |
country | Australia |
data_context | Reference genome |
data_custodian | Emily Roycroft |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351908 |
date_of_transfer | 2023-12-19 |
date_of_transfer_to_archive | 2023-12-22 |
decimal_latitude_public | -18.1871 |
decimal_longitude_public | 125.5836 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456752_AusARG_BRF_222VJYLT4_TCAGCATC |
family | Gekkonidae |
file_type | fastq.gz |
flowcell_id | 222VJYLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20231215_AusARG_BRF_222VJYLT4 |
genotypic_sex | female |
genus | Gehyra |
identified_by | Stephen Zozaya |
insert_size_range | ~900bp |
institution_name | Australian National University |
latitude | -18.1871 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456752 |
library_index_id | index_5 |
library_index_seq | TCAGCATC |
library_layout | paierd-end |
library_location | Freezer at BRF |
library_ng_ul | 5.96 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAGCATC(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-11-23 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | adult |
location_text | Fitzroy Crossing, Crossing Inn |
longitude | 125.5836 |
material_extracted_by | BRF ANU |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | external and internal morphology |
n_libraries_pooled | 11 |
order | Squamata |
phenotypic_sex | female |
phylum | Chordata |
prior_genetics | NA |
project_aim | Reference genome |
sample_custodian | Craig Moritz |
sample_id | 102.100.100/458262 |
sample_quality | high |
scientific_name | Common eastern froglet (Crinia signifera), Eungella Leaf-tailed Gecko (Phyllurus nephtys), Southern ornate nursery frog (Cophixalus australis), Gehyra sp. x8 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq X series 25B 300 cycles |
sequencing_model | Illumina NovaSeq X |
sequencing_platform | ILLUMINA |
species | gemina |
specimen_id | CCM8051 |
specimen_id_description | ANU tissue collection |
state_or_region | Western Australia |
subspecies | NA |
taxon_id | 2856562 |
taxonomic_group | lizard |
ticket | BPAOPS-1538 |
tissue_collection | Moritz Lab ANU |
tissue_number | CCM8051 |
tissue_preservation | frozen -80 |
tissue_type | tail muscle |
type_status | no |
voucher_or_tissue_number | CCM8051 |
wild_captive | wild |
work_order | 13072 |