Southern Ornate Nursery Frog, Reference genome, Illumina-HiC, liver
Dataset size is: 240.96 GiB
This dataset is currently under a short embargo period until December 18, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
-
456750_AusARG_BRF_222VJYLT4_TAGA... Metadata Only FASTQ
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-12-18 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | individual for Cophixalus genome assembly |
associated_media | IMG_5124 |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1538/20231215_AusARG_BRF_222VJYLT4/20231215_AusARG_BRF_351906_222VJYLT4/ |
bioplatforms_dataset_id | multiple (11x) |
bioplatforms_library_id | multiple (11x) |
bioplatforms_sample_id | multiple (11x) |
certainty | probable (75%) |
class | Amphibia |
collection_date | 2023-05-15 |
collection_method | searching under artificial nursery frog nest boxes |
collector | Conrad Hoskin |
collector_sample_id | CONX6642 |
common_name | Southern Ornate Nursery Frog |
country | Australia |
data_context | Reference genome |
data_custodian | Megan Higgie |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351906 |
date_of_transfer | 2023-12-19 |
date_of_transfer_to_archive | 2023-12-22 |
death_date | 2023-05-17 |
decimal_latitude_public | -19.0095 |
decimal_longitude_public | 146.20808 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456750_AusARG_BRF_222VJYLT4_TAGACCAA |
family | Microhylidae |
file_type | fastq.gz |
flowcell_id | 222VJYLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20231215_AusARG_BRF_222VJYLT4 |
genotypic_sex | not determined |
genus | Cophixalus |
habitat | tropical moist broadleaf forest (upland rainforest) |
identified_by | Conrad Hoskin |
insert_size_range | ~900bp |
institution_name | James Cook University |
latitude | -19.0095 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456750 |
library_index_id | index_2 |
library_index_seq | TAGACCAA |
library_layout | paired-end |
library_location | Freezer at BRF |
library_ng_ul | 3.1 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGACCAA(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-11-23 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | adult organism |
location_text | adjacent to Whalley Cr in Paluma Village |
longitude | 146.20808 |
material_extracted_by | BRF ANU |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | dissection |
n_libraries_pooled | 11 |
order | Anura |
phenotypic_sex | female |
phylum | Chordata |
prior_genetics | NA |
project_aim | Reference genome |
sample_custodian | Megan Higgie | Conrad Hoskin |
sample_id | 102.100.100/458260 |
sample_quality | freshly sampled |
scientific_name | Common eastern froglet (Crinia signifera), Eungella Leaf-tailed Gecko (Phyllurus nephtys), Southern ornate nursery frog (Cophixalus australis), Gehyra sp. x8 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq X series 25B 300 cycles |
sequencing_model | Illumina NovaSeq X |
sequencing_platform | ILLUMINA |
source_population | Australia, Queensland, Paluma Uplands |
species | australis |
specimen_id | TBA |
specimen_id_description | Queensland Museum |
state_or_region | Queensland |
subspecies | NA |
taxon_id | 306589 |
taxonomic_group | frog |
ticket | BPAOPS-1538 |
tissue_collection | Adaptation Lab (Higgie & Hoskin) |
tissue_number | CONX6638 |
tissue_preservation | frozen | -80C |
tissue_type | liver |
type_status | no |
voucher_or_tissue_number | CONX6642 |
wild_captive | wild |
work_order | 13072 |