Common Eastern Froglet, Reference genome, Illumina-HiC, heart
Dataset size is: 86.41 GiB
This dataset is currently under a short embargo period until December 18, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-12-18 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1538/20231215_AusARG_BRF_222VJYLT4/20231215_AusARG_BRF_351901_222VJYLT4/ |
bioplatforms_dataset_id | multiple (11x) |
bioplatforms_library_id | multiple (11x) |
bioplatforms_sample_id | multiple (11x) |
certainty | medium-high, testes-like structures |
class | Amphibia |
collection_date | 2023-10-04 |
collection_method | Collected from wild by hand |
collector | Tiffany Kosch | Melissa Hernandez Poveda | University of Melbourne | Ben Scheele | Australian National University |
collector_sample_id | crsi_2 |
common_name | Common Eastern Froglet |
country | Australia |
data_context | Reference genome |
data_custodian | Tiffany Kosch |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351901 |
date_of_transfer | 2023-12-19 |
date_of_transfer_to_archive | 2023-12-22 |
death_date | 2023-10-04 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456747_AusARG_BRF_222VJYLT4_CAAGGTGA |
family | Myobatrachidae |
file_type | fastq.gz |
flowcell_id | 222VJYLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20231215_AusARG_BRF_222VJYLT4 |
genotypic_sex | male |
genus | Crinia |
habitat | Alpine Sphagnum Bogs and Associated Fens Ecological Community |
identified_by | Ben Scheele |
insert_size_range | ~900bp |
institution_name | University of Melbourne |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456747 |
library_index_id | index_1 |
library_index_seq | CAAGGTGA |
library_layout | paired-end |
library_location | Freezer at BRF |
library_ng_ul | 5.9 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAAGGTGA(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-11-20 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | adult |
location_text | Snowy Flats, Namadgi National Park |
material_conc_ng_ul | TBA |
material_extracted_by | BRF |
material_extraction_method | TBA |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | dissection |
n_libraries_pooled | 11 |
order | Anura |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | NA |
project_aim | Reference genome |
sample_custodian | Tiffany Kosch |
sample_id | 102.100.100/458258 |
sample_quality | fresh frozen |
scientific_name | Common eastern froglet (Crinia signifera), Eungella Leaf-tailed Gecko (Phyllurus nephtys), Southern ornate nursery frog (Cophixalus australis), Gehyra sp. x8 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq X series 25B 300 cycles |
sequencing_model | Illumina NovaSeq X |
sequencing_platform | ILLUMINA |
species | signifera |
specimen_id | A4129 |
specimen_id_description | ANWC |
state_or_region | Australia Capital Territory |
subspecies | NA |
taxon_id | 326986 |
taxonomic_group | frog |
ticket | BPAOPS-1538 |
tissue_number | crsi_2_heart |
tissue_preservation | flash_frozen |
tissue_type | heart |
type_status | NA |
voucher_or_tissue_number | A4129 |
wild_captive | wild-caught |
work_order | 13072 |