Common Eastern Froglet, Reference genome, Illumina-HiC, heart
Dataset size is: 86.41 GiB
Data and Resources
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
-
456747_AusARG_BRF_222VJYLT4_CAAG... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
Access Control Date | 2023-12-29 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1538/20231215_AusARG_BRF_222VJYLT4/20231215_AusARG_BRF_351901_222VJYLT4/ |
bioplatforms_dataset_id | multiple (11x) |
bioplatforms_library_id | multiple (11x) |
bioplatforms_sample_id | multiple (11x) |
certainty | medium-high, testes-like structures |
class | Amphibia |
collection_date | 2023-10-04 |
collection_method | Collected from wild by hand |
collector | Tiffany Kosch | Melissa Hernandez Poveda | University of Melbourne | Ben Scheele | Australian National University |
collector_sample_id | crsi_2 |
common_name | Common Eastern Froglet |
country | Australia |
data_context | Reference genome |
data_custodian | Tiffany Kosch |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351901 |
date_of_transfer | 2023-12-19 |
date_of_transfer_to_archive | 2023-12-22 |
death_date | 2023-10-04 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456747_AusARG_BRF_222VJYLT4_CAAGGTGA |
family | Myobatrachidae |
file_type | fastq.gz |
flowcell_id | 222VJYLT4 |
flowcell_type | NovaSeq X 25B |
folder_name | 20231215_AusARG_BRF_222VJYLT4 |
genotypic_sex | male |
genus | Crinia |
habitat | Alpine Sphagnum Bogs and Associated Fens Ecological Community |
identified_by | Ben Scheele |
insert_size_range | ~900bp |
institution_name | University of Melbourne |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456747 |
library_index_id | index_1 |
library_index_seq | CAAGGTGA |
library_layout | paired-end |
library_location | Freezer at BRF |
library_ng_ul | 5.9 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAAGGTGA(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-11-20 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | adult |
location_text | Snowy Flats, Namadgi National Park |
material_conc_ng_ul | NA |
material_extracted_by | BRF |
material_extraction_method | NA |
material_extraction_type | DNA |
metadata_revision_date | 2024-11-15 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
method_of_determination | dissection |
n_libraries_pooled | 11 |
order | Anura |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | NA |
project_aim | Reference genome |
sample_custodian | Tiffany Kosch |
sample_id | 102.100.100/458258 |
sample_quality | fresh frozen |
scientific_name | Common eastern froglet (Crinia signifera), Eungella Leaf-tailed Gecko (Phyllurus nephtys), Southern ornate nursery frog (Cophixalus australis), Gehyra sp. x8 |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq X series 25B 300 cycles |
sequencing_model | Illumina NovaSeq X |
sequencing_platform | ILLUMINA |
source_population | NA |
species | signifera |
specimen_id | A4129 |
specimen_id_description | ANWC |
state_or_region | Australia Capital Territory |
subspecies | NA |
taxon_id | 326986 |
taxonomic_group | frog |
ticket | BPAOPS-1538 |
tissue_number | crsi_2_heart |
tissue_preservation | flash_frozen |
tissue_type | heart |
type_status | NA |
voucher_or_tissue_number | A4129 |
wild_captive | wild-caught |
work_order | 13072 |