Fletcher's frog, Reference Genome, Illumina-HiC, Heart

Limnodynastidae, Lechriodus fletcheri, SCL015, frog, Project Lead: Renee Catullo

Dataset size is: 68.82 GiB

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2023-08-20
Access Control Mode date
Sequence Data Type illumina-hic
ala_specimen_url NA
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1458/20230810_AusARG_BRF_351897_HKJ33DRX3/
bioplatforms_dataset_id 351897
bioplatforms_library_id 456721
bioplatforms_sample_id 458238
certainty unknown
class Amphibia
collection_date 2020-12-15
collector Simon Clulow
collector_sample_id SCL015
common_name Fletcher's frog
country Australia
data_context Reference Genome
data_custodian Renee Catullo
data_type Illumina-HiC
dataset_id 102.100.100/351897
date_of_transfer 2023-08-10
date_of_transfer_to_archive 2023-08-14
death_date 2020-12-21
description HiC
dna_treatment FA crosllinking restriction enzymes and sonication
experimental_design Arima HiC 2.0 single index
facility BRF
facility_project_code NA
facility_sample_id 456721_AusARG_BRF_HKJ33DRX3_CTACAATG
family Limnodynastidae
file_type fastq.gz
flowcell_id HKJ33DRX3
flowcell_type NovaSeq 6000 SP
folder_name 20230810_AusARG_BRF_351897_HKJ33DRX3
genotypic_sex not determined
genus Lechriodus
identified_by Simon Clulow
insert_size_range ~1000bp
institution_name University of Canberra
library_comments Concentration and size was assesd by Bioanalyzer and Qubit
library_construction_protocol Arima HiC 2.0
library_id 456721
library_index_id Index_14
library_index_seq CTACAATG
library_layout paired-end
library_location Freezer at BRF
library_ng_ul 1.45
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTACAATG(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 6
library_pcr_reps 1
library_prep_date 2023-07-17
library_prepared_by Max Nekrasov
library_selection Restriction Digest
library_source GENOMIC
library_strategy Hi-C
library_type Illumina-HiC
lifestage unknown
location_text Watagan Mountains
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination Gonad
n_libraries_pooled 2
order Anura
phenotypic_sex Male
phylum Chordata
prior_genetics NA
project_aim Reference genome
sample_custodian Arthur George
sample_id 102.100.100/458238
scientific_name Lechriodus fletcheri
sequencing_facility BRF
sequencing_kit_chemistry_version NovaSeq v1.5
sequencing_model Illumina NovaSeq 6000
sequencing_platform ILLUMINA
source_population NA
species fletcheri
specimen_id SCL015
state_or_region New South Wales
subspecies NA
taxonomic_group frog
ticket BPAOPS-1458
tissue_collection University of Canberra Wildlife Tissue Collection
tissue_number SC154
tissue_preservation Snap Frozen
tissue_type Heart
voucher_or_tissue_number SC154
wild_captive wild-caught
work_order 13066