Ornate burrowing frog, Reference Genome, Illumina-HiC, Heart
Dataset size is: 71.63 GiB
This dataset is currently under a short embargo period until August 9, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-08-09 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1458/20230810_AusARG_BRF_351896_HKJ33DRX3/ |
bioplatforms_dataset_id | 351897 |
bioplatforms_library_id | 456721 |
bioplatforms_sample_id | 458238 |
certainty | unknown |
class | Amphibia |
collection_date | 2020-12-08 |
collector | Simon Clulow |
collector_sample_id | SC033 |
common_name | Ornate burrowing frog |
country | Australia |
data_context | Reference Genome |
data_custodian | Renee Catullo |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351896 |
date_of_transfer | 2023-08-10 |
date_of_transfer_to_archive | 2023-08-14 |
death_date | 2020-12-21 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 456720_AusARG_BRF_HKJ33DRX3_GACTTGAC |
family | Limnodynastidae |
file_type | fastq.gz |
flowcell_id | HKJ33DRX3 |
flowcell_type | NovaSeq 6000 SP |
folder_name | 20230810_AusARG_BRF_351897_HKJ33DRX3 |
genotypic_sex | not detemined |
genus | Platyplectrum |
identified_by | Simon Clulow |
insert_size_range | ~1000bp |
institution_name | University of Canberra |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 456720 |
library_index_id | Index_13 |
library_index_seq | GACTTGAC |
library_layout | paired-end |
library_location | Freezer at BRF |
library_ng_ul | 1.45 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGACTTGAC(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 6 |
library_pcr_reps | 1 |
library_prep_date | 2023-07-17 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | unknown |
location_text | Whiporie |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | Gonad |
n_libraries_pooled | 2 |
order | Anura |
phenotypic_sex | Male |
phylum | Chordata |
prior_genetics | NA |
project_aim | Reference genome |
sample_custodian | Arthur George |
sample_id | 102.100.100/458237 |
scientific_name | Lechriodus fletcheri |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | NovaSeq v1.5 |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
species | ornatum |
specimen_id | SCL005 |
state_or_region | New South Wales |
subspecies | NA |
taxonomic_group | frog |
ticket | BPAOPS-1458 |
tissue_collection | University of Canberra Wildlife Tissue Collection |
tissue_number | SC033 |
tissue_preservation | Snap Frozen |
tissue_type | Heart |
voucher_or_tissue_number | SC033 |
wild_captive | wild-caught |
work_order | 13066 |