Green-eyed tree frog, Reference Genome, Illumina-HiC, liver
Dataset size is: 58.69 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2022-10-28 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | No restrictions |
analysis_software | Bcl2Fastq |
ancillary_notes | in amplexus with CONX5984 when collected, 50 tadpoles from this mating are sampled in ethanol |
associated_media | photo: IMG_1692.jpg |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1154/ |
bioplatforms_dataset_id | 351780, 351810, 351812, 351814, 351816 |
bioplatforms_library_id | 350845, 353995, 353996, 353997, 353998 |
bioplatforms_sample_id | 349834, 352981, 352982, 352983, 352984 |
certainty | high |
class | Amphibia |
collection_date | 2021-02-26 |
collection_method | spotlighting |
collector | Conrad Hoskin | Lorenzo Bertola | James Cook University |
collector_sample_id | CONX5985 |
common_name | Green-eyed tree frog |
country | Australia |
data_context | Reference Genome |
data_custodian | Megan Higgie |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351816 |
date_of_transfer | 2021-10-28 |
date_of_transfer_to_archive | 2021-10-29 |
death_date | 2021-02-28 |
decimal_latitude_public | -17.53946 |
decimal_longitude_public | 145.68899 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_project_code | NA |
facility_sample_id | 353998_HMGMJDRXY_CAGATC |
family | Hylidae |
file_type | FASTQ |
flowcell_id | HMGMJDRXY |
flowcell_type | Novaseq S1 |
folder_name | 20211027_AusARG_BRF_HMGMJDRXY |
genotypic_sex | not determined |
genus | Ranoidea (Litoria) |
habitat | tropical mixed forest biome |
identified_by | Conrad Hoskin |
insert_size_range | 650.0 |
institution_name | James Cook University |
latitude | -17.53946 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 353998 |
library_index_id | Index 7 |
library_index_seq | CAGATC |
library_layout | paired end |
library_location | Freezer at BRF |
library_ng_ul | 1.3 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATC(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 7 |
library_pcr_reps | 1 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | Illumina-HiC |
lifestage | prime adult stage |
location_text | Tributary of North Johnstone River, 200 m north-east from Mungalli Creek Dairy Café, Brooks Rd, Mungalli, |
longitude | 145.68899 |
material_conc_ng_ul | TBA |
material_extracted_by | BRF ANU | |
material_extraction_method | TBA |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | presence of nuptial pads |
n_libraries_pooled | 5 |
order | Anura |
phenotypic_sex | male |
phylum | Chordata |
project_aim | Reference genome |
sample_custodian | Megan Higgie | Conrad Hoskin |
sample_id | 102.100.100/352984 |
sample_quality | freshly sampled |
scientific_name | Hydrophis major, Lampropholis delicata, Pseudemoia entrecasteauxii, Saiphos equalis, Litoria serrata |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
source_population | Australia, Queensland, Wet Tropics, Atherton tablelands |
species | serrata |
specimen_id | TBC |
specimen_id_description | Queensland Museum |
state_or_region | Queensland |
subspecies | southern lineage |
taxon_id | 143878 |
taxonomic_group | frog |
ticket | BPAOPS-1154 |
tissue_collection | Adaptation Lab (Higgie & Hoskin) |
tissue_number | CONX5974 |
tissue_preservation | frozen | -80C | none |
tissue_type | liver |
type_status | unknown |
voucher_or_tissue_number | CONX5985 |
wild_captive | wild |
work_order | 13026 |