Green-eyed tree frog, Reference Genome, Illumina-HiC, liver

Hylidae, Ranoidea (Litoria) serrata, TBC, frog, Project Lead: Megan Higgie

Dataset size is: 58.69 GiB

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2021-11-07
Access Control Mode date
Sequence Data Type illumina-hic
access_rights No restrictions
analysis_software Bcl2Fastq
ancillary_notes in amplexus with CONX5984 when collected, 50 tadpoles from this mating are sampled in ethanol
associated_media photo: IMG_1692.jpg
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1154/
bioplatforms_dataset_id 351780, 351810, 351812, 351814, 351816
bioplatforms_library_id 350845, 353995, 353996, 353997, 353998
bioplatforms_sample_id 349834, 352981, 352982, 352983, 352984
certainty high
class Amphibia
collection_date 2021-02-26
collection_method spotlighting
collector Conrad Hoskin | Lorenzo Bertola | James Cook University
collector_sample_id CONX5985
common_name Green-eyed tree frog
country Australia
data_context Reference Genome
data_custodian Megan Higgie
data_type Illumina-HiC
dataset_id 102.100.100/351816
date_of_transfer 2021-10-28
date_of_transfer_to_archive 2021-10-29
death_date 2021-02-28
decimal_latitude_public -17.53946
decimal_longitude_public 145.68899
description HiC
dna_treatment FA crosllinking restriction enzymes and sonication
experimental_design Arima HiC 2.0 single index
facility BRF
facility_project_code NA
facility_sample_id 353998_HMGMJDRXY_CAGATC
family Hylidae
file_type FASTQ
flowcell_id HMGMJDRXY
flowcell_type Novaseq S1
folder_name 20211027_AusARG_BRF_HMGMJDRXY
genotypic_sex not determined
genus Ranoidea (Litoria)
habitat tropical mixed forest biome
identified_by Conrad Hoskin
insert_size_range 650.0
institution_name James Cook University
latitude -17.53946
library_comments Concentration and size was assesd by Bioanalyzer and Qubit
library_construction_protocol Arima HiC 2.0
library_id 353998
library_index_id Index 7
library_index_seq CAGATC
library_layout paired end
library_location Freezer at BRF
library_ng_ul 1.3
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATC(AT)CTCGTATGCCGTCTTCTGCTTG
library_pcr_cycles 7
library_pcr_reps 1
library_prepared_by Max Nekrasov
library_selection Restriction Digest
library_source GENOMIC
library_strategy Hi-C
library_type Illumina-HiC
lifestage prime adult stage
location_text Tributary of North Johnstone River, 200 m north-east from Mungalli Creek Dairy Café, Brooks Rd, Mungalli,
longitude 145.68899
material_conc_ng_ul TBA
material_extracted_by BRF ANU |
material_extraction_method TBA
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination presence of nuptial pads
n_libraries_pooled 5
order Anura
phenotypic_sex male
phylum Chordata
project_aim Reference genome
sample_custodian Megan Higgie | Conrad Hoskin
sample_id 102.100.100/352984
sample_quality freshly sampled
scientific_name Hydrophis major, Lampropholis delicata, Pseudemoia entrecasteauxii, Saiphos equalis, Litoria serrata
sequencing_facility BRF
sequencing_kit_chemistry_version 300 cycles
sequencing_model Illumina NovaSeq 6000
sequencing_platform ILLUMINA
source_population Australia, Queensland, Wet Tropics, Atherton tablelands
species serrata
specimen_id TBC
specimen_id_description Queensland Museum
state_or_region Queensland
subspecies southern lineage
taxon_id 143878
taxonomic_group frog
ticket BPAOPS-1154
tissue_collection Adaptation Lab (Higgie & Hoskin)
tissue_number CONX5974
tissue_preservation frozen | -80C | none
tissue_type liver
type_status unknown
voucher_or_tissue_number CONX5985
wild_captive wild
work_order 13026