Green-eyed tree frog, Reference Genome, Illumina-HiC, liver
Dataset size is: 58.69 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2022-10-28 |
| Access Control Mode | date |
| Sequence Data Type | illumina-hic |
| access_rights | No restrictions |
| analysis_software | Bcl2Fastq |
| ancillary_notes | in amplexus with CONX5984 when collected, 50 tadpoles from this mating are sampled in ethanol |
| associated_media | photo: IMG_1692.jpg |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1154/ |
| bioplatforms_dataset_id | 351780, 351810, 351812, 351814, 351816 |
| bioplatforms_library_id | 350845, 353995, 353996, 353997, 353998 |
| bioplatforms_sample_id | 349834, 352981, 352982, 352983, 352984 |
| certainty | high |
| class | Amphibia |
| collection_date | 2021-02-26 |
| collection_method | spotlighting |
| collector | Conrad Hoskin | Lorenzo Bertola | James Cook University |
| collector_sample_id | CONX5985 |
| common_name | Green-eyed tree frog |
| country | Australia |
| data_context | Reference Genome |
| data_custodian | Megan Higgie |
| data_type | Illumina-HiC |
| dataset_id | 102.100.100/351816 |
| date_of_transfer | 2021-10-28 |
| date_of_transfer_to_archive | 2021-10-29 |
| death_date | 2021-02-28 |
| decimal_latitude_public | -17.53946 |
| decimal_longitude_public | 145.68899 |
| description | HiC |
| dna_treatment | FA crosllinking restriction enzymes and sonication |
| experimental_design | Arima HiC 2.0 single index |
| facility | BRF |
| facility_project_code | NA |
| facility_sample_id | 353998_HMGMJDRXY_CAGATC |
| family | Hylidae |
| file_type | FASTQ |
| flowcell_id | HMGMJDRXY |
| flowcell_type | Novaseq S1 |
| folder_name | 20211027_AusARG_BRF_HMGMJDRXY |
| genotypic_sex | not determined |
| genus | Ranoidea (Litoria) |
| habitat | tropical mixed forest biome |
| identified_by | Conrad Hoskin |
| insert_size_range | 650.0 |
| institution_name | James Cook University |
| latitude | -17.53946 |
| library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
| library_construction_protocol | Arima HiC 2.0 |
| library_id | 353998 |
| library_index_id | Index 7 |
| library_index_seq | CAGATC |
| library_layout | paired end |
| library_location | Freezer at BRF |
| library_ng_ul | 1.3 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATC(AT)CTCGTATGCCGTCTTCTGCTTG |
| library_pcr_cycles | 7 |
| library_pcr_reps | 1 |
| library_prepared_by | Max Nekrasov |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | Hi-C |
| library_type | Illumina-HiC |
| lifestage | prime adult stage |
| location_text | Tributary of North Johnstone River, 200 m north-east from Mungalli Creek Dairy Café, Brooks Rd, Mungalli, |
| longitude | 145.68899 |
| material_conc_ng_ul | TBA |
| material_extracted_by | BRF ANU | |
| material_extraction_method | TBA |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-01-25 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
| method_of_determination | presence of nuptial pads |
| n_libraries_pooled | 5 |
| order | Anura |
| phenotypic_sex | male |
| phylum | Chordata |
| project_aim | Reference genome |
| sample_custodian | Megan Higgie | Conrad Hoskin |
| sample_id | 102.100.100/352984 |
| sample_quality | freshly sampled |
| scientific_name | Hydrophis major, Lampropholis delicata, Pseudemoia entrecasteauxii, Saiphos equalis, Litoria serrata |
| sequencing_facility | BRF |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | Illumina NovaSeq 6000 |
| sequencing_platform | ILLUMINA |
| source_population | Australia, Queensland, Wet Tropics, Atherton tablelands |
| species | serrata |
| specimen_id | TBC |
| specimen_id_description | Queensland Museum |
| state_or_region | Queensland |
| subspecies | southern lineage |
| taxon_id | 143878 |
| taxonomic_group | frog |
| ticket | BPAOPS-1154 |
| tissue_collection | Adaptation Lab (Higgie & Hoskin) |
| tissue_number | CONX5974 |
| tissue_preservation | frozen | -80C | none |
| tissue_type | liver |
| type_status | unknown |
| voucher_or_tissue_number | CONX5985 |
| wild_captive | wild |
| work_order | 13026 |