shingleback/sleepy lizard/bobtail, Reference Genome, Illumina-HiC, muscle structure
Dataset size is: 42.16 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2022-06-15 |
Access Control Mode | date |
Sequence Data Type | illumina-hic |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | Animal was taken from bundey Bore Station homestead area and was put into captivity after the life in cold blood series in 2008. In regards to the common name - given this is a South Australian animal is common name is the sleepy lizard rather than shingleback or bobtail. |
associated_media | TrG_genomeLizard1_ventral.jpg; TrG_genomeLizard1_WholeDorsal.jpg; TrG_genomeLizard2_ventral.jpg; TrG_genomeLizard1_Head.jpg; TrG_GenomeLizard_4March2020_Face.jpg |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/genomics-hi-c/BPAOPS-1084/20210611_AusARG_BRF_HCN7WDRXY/ |
bioplatforms_dataset_id | 351742 |
bioplatforms_library_id | 350752, 350764, 350769, 350768, 350781, 350821 |
bioplatforms_sample_id | 349751, 349763, 349765, 349764, 349775, 349811 |
certainty | certain |
class | Reptilia |
collection_date | 2008-01-01 |
collection_method | hand capture |
collector | Dale Burzacott |
collector_sample_id | NA |
common_name | shingleback/sleepy lizard/bobtail |
country | Australia |
data_context | Reference Genome |
data_custodian | Terry Bertozzi |
data_type | Illumina-HiC |
dataset_id | 102.100.100/351741 |
date_of_transfer | 2021-06-15 |
date_of_transfer_to_archive | 2021-06-16 |
death_date | 2020-03-04 |
decimal_latitude_public | -33.886547 |
decimal_longitude_public | 139.355269 |
description | HiC |
dna_treatment | FA crosllinking restriction enzymes and sonication |
experimental_design | Arima HiC 2.0 single index |
facility | BRF |
facility_sample_id | 350781_HCN7WDRXY_CTTGTA |
family | Scincidae |
file_type | FASTQ |
flowcell_id | HCN7WDRXY |
flowcell_type | Novaseq S1 |
folder_name | 20210611_AusARG_BRF_HCN7WDRXY |
genotypic_sex | male |
genus | Tiliqua |
habitat | xeric shrubland biome |
identified_by | Mike Gardner |
insert_size_range | 650.0 |
institution_name | South Australian Museum |
latitude | -33.886547 |
library_comments | Concentration and size was assesd by Bioanalyzer and Qubit |
library_construction_protocol | Arima HiC 2.0 |
library_id | 350781 |
library_index_id | Index 12 |
library_index_seq | CTTGTA |
library_layout | paired end |
library_location | Freezer at BRF |
library_ng_ul | 1.2 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTA(AT)CTCGTATGCCGTCTTCTGCTTG |
library_pcr_cycles | 8 |
library_pcr_reps | 1 |
library_prepared_by | Max Nekrasov |
library_selection | Restriction Digest |
library_source | GENOMIC |
library_strategy | Hi-C |
library_type | HiC |
lifestage | adult |
location_text | Bundey Bore Station homestead |
longitude | 139.355269 |
material_conc_ng_ul | NA |
material_extracted_by | NA |
material_extraction_method | NA |
material_extraction_type | NA |
metadata_revision_date | 2024-11-15 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
method_of_determination | dissection and sexing marker |
n_libraries_pooled | 6 |
order | Squamata |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | spleen transcriptome |
project_aim | Reference genome |
sample_custodian | Terry Bertozzi | Michael Gardner |
sample_id | 102.100.100/349775 |
sample_quality | excellent |
scientific_name | Platyplectrum ornatum/Chelodina expansa/Bassiana duperreyi/Pogona vitticeps/Tiliqua rugosa/(Emydura macquarii?) |
sequencing_facility | BRF |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | Illumina NovaSeq 6000 |
sequencing_platform | ILLUMINA |
source_population | NA |
species | rugosa |
specimen_id | SAMAR71619 |
specimen_id_description | South Australian Museum |
state_or_region | South Australia |
subspecies | asper |
taxon_id | 8527 |
taxonomic_group | lizard |
ticket | BPAOPS-1084 |
tissue_collection | Australian Biological Tissue Collection |
tissue_number | ABTC151652 |
tissue_preservation | liquid nitrogen | -80C |
tissue_type | muscle structure |
type_status | no |
voucher_or_tissue_number | SAMAR71619 |
wild_captive | wild (captive since 2008) |
work_order | 13015 |