Conservation genomics, Illumina ddRAD-seq

Nicholas Bail

Dataset size is: 131.86 GiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2025-04-11
Access Control Mode date
Sequence Data Type illumina-ddrad
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/ddrad/BPAOPS-1573/20240328_AusARG_AGRF_22JKKGLT3/
bpa_dataset_id 102.100.100/351891
data_context Conservation genomics
data_custodian Nicholas Bail
data_type Illumina ddRAD-seq
dataset_id 102.100.100/351891
date_of_transfer 2024-04-11
date_of_transfer_to_archive 2024-04-11
description Short reads
experimental_design PstI/HpyCh4III
facility_project_code CAGRF230715410
flowcell_id 22JKKGLT3
flowcell_type 10B
folder_name 20240328_AusARG_AGRF_22JKKGLT3
insert_size_range 280-342bp
library_construction_protocol ddRAD (based on Peterson et al 2012)
library_layout paired end
library_location AGRF_Perth
library_oligo_sequence AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G
library_pcr_cycles 11
library_pcr_reps 7
library_prep_date 2024-03-06
library_prepared_by Jeremy Beerkens
library_selection Restriction Digest
library_source GENOMIC
library_strategy RAD-Seq
library_type Illumina-ddRAD
n_libraries_pooled 4.0
sequencing_facility AGRF_Melboune
sequencing_model NovaSeq X Plus
sequencing_platform ILLUMINA
ticket BPAOPS-1573
work_order 13064