Conservation genomics, Illumina ddRAD-seq
Dataset size is: 130.91 GiB
This dataset is currently under a short embargo period until April 11, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
-
AusARG_AGRF_CAGRF220510562_22JKK... Metadata Only XLSX
-
351832_AusARG_AGRF_22JKKGLT3_ACA... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_GCC... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_CTT... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_CTT... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_ACA... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_GCC... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_TGA... Metadata Only FASTQ
-
351832_AusARG_AGRF_22JKKGLT3_TGA... Metadata Only FASTQ
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-04-11 |
| Access Control Mode | date |
| Sequence Data Type | illumina-ddrad |
| access_rights | Location information restricted |
| ala_specimen_url | NA |
| associated_media | none |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/ddrad/BPAOPS-1575/20240328_AusARG_AGRF_CAGRF220510562_22JKKGLT3/ |
| bpa_dataset_id | 102.100.100/351832 |
| class | Lepidosauria |
| collection_method | unknown |
| country | Australia |
| data_context | Conservation genomics |
| data_custodian | Nicholas Bail |
| data_type | Illumina ddRAD-seq |
| dataset_id | 102.100.100/351832 |
| date_of_transfer | 2024-04-11 |
| date_of_transfer_to_archive | 2024-04-11 |
| description | Short reads |
| experimental_design | PstI/HpyCh4III |
| facility_project_code | CAGRF220510562 |
| family | Carphodactylidae |
| flowcell_id | 22JKKGLT3 |
| flowcell_type | 10B |
| folder_name | 20240328_AusARG_AGRF_CAGRF220510562_22JKKGLT3 |
| genotypic_sex | not determined |
| insert_size_range | 280-342bp |
| library_construction_protocol | ddRAD (based on Peterson et al 2012) |
| library_layout | paired end |
| library_location | AGRF_Perth |
| library_oligo_sequence | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC*G |
| library_pcr_cycles | 11 |
| library_pcr_reps | 7 |
| library_prep_date | 2024-03-06 |
| library_prepared_by | Jeremy Beerkens |
| library_selection | Restriction Digest |
| library_source | GENOMIC |
| library_strategy | RAD-Seq |
| library_type | Illumina-ddRAD |
| material_conc_ng_ul | NA |
| material_extracted_by | NA |
| material_extraction_method | NA |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-01-25 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
| n_libraries_pooled | 4.0 |
| order | Squamata |
| phylum | Chordata |
| prior_genetics | none |
| sample_custodian | Conrad Hoskin (James Cook University) |
| sample_quality | good |
| sequencing_facility | AGRF_Melboune |
| sequencing_model | NovaSeq X Plus |
| sequencing_platform | ILLUMINA |
| source_population | NA |
| taxonomic_group | lizard |
| ticket | BPAOPS-1575 |
| tissue_preservation | frozen | ethanol |
| type_status | NA |
| wild_captive | wild |
| work_order | 13046 |