Northern Small-eyed Snake, Phylogenomics, Illumina Capture, unknown
Dataset size is: 1.84 GiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members |
Access Control Date | 2024-05-13 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | 2dd72bee-3616-499f-9976-6dd4b7f9aa6e |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
certainty | NA |
class | Reptilia |
collection_method | unknown |
collector | unknown |
collector_sample_id | unknown |
common_name | Northern Small-eyed Snake |
country | Australia |
data_context | Phylogenomics |
data_custodian | Scott Keogh |
data_type | Illumina Capture |
dataset_id | 102.100.100/351864 |
date_of_transfer | 2024-05-03 |
date_of_transfer_to_archive | 2024-05-07 |
decimal_latitude_public | -12.63 |
decimal_longitude_public | 131.25 |
description | Short reads |
dna_treatment | 5 Bioruptor cycles |
experimental_design | Capture probes |
facility | BRF |
family | Elapidae |
file_type | FASTQ |
flowcell_id | 222VTMLT1 |
flowcell_type | Novaseq X |
folder_name | 20240305_AusARG_BRF_222VTMLT1 |
genotypic_sex | not determined |
genus | Cryptophis |
habitat | unknown |
identified_by | unknown |
insert_size_range | 150bp PE |
institution_name | South Australian Museum |
latitude | -12.63 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/455561 |
library_index_id | p7_UDI_1145 |
library_index_id_dual | p5_UDI_1145 |
library_index_seq | TGTCTCTAGT |
library_index_seq_dual | TGTTATGTTA |
library_layout | paired end |
library_location | EBL Freezer |
library_ng_ul | 3.9 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGTCTCTAGTATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACTGTTATGTTAACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 7 |
library_pcr_reps | 2 |
library_prep_date | 2024-03-28 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | not determined |
location_text | Nr humpty doo |
longitude | 131.25 |
material_conc_ng_ul | 24.9 |
material_extracted_by | Liz Broady |
material_extraction_date | 2023-03-03 |
material_extraction_method | Macherey-Nagel Plate Extraction Kit |
material_extraction_type | DNA |
metadata_revision_date | 2024-11-15 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 192 |
order | Squamata |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Phylogenomics |
sample_custodian | Scott Keogh |
sample_id | 102.100.100/454080 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
source_population | NA |
species | pallidiceps |
species_name | Cryptophis pallidiceps |
specimen_id | SAMA R29957 |
specimen_id_description | South Australian Museum |
state_or_region | Northern Territory |
subspecies | NA |
taxon_id | 1194343 |
taxonomic_group | Elapidae |
ticket | BPAOPS-1578 |
tissue_collection | Australian Biological Tissue Collection |
tissue_number | ABTC55642 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | NA |
voucher_or_tissue_number | R29957 |
wild_captive | wild |
work_order | 13078 |