Persian Gulf sea snake, Phylogenomics, Illumina Capture, liver

Elapidae, Hydrophis lapemoides, CAS216443, Elapidae, Project Lead: Scott Keogh

Dataset size is: 640.45 MiB

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:10:ausarg-consortium-members
Access Control Date 2024-05-13
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url NA
analysis_software Bcl2Fastq
ancillary_notes CAS database has ornatus as species name
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/
certainty NA
class Reptilia
collection_date 2000-11-27
collection_method unknown
collector JB Slowinski | H Win
collector_sample_id unknown
common_name Persian Gulf sea snake
country Burma
data_context Phylogenomics
data_custodian Scott Keogh
data_type Illumina Capture
dataset_id 102.100.100/351864
date_of_transfer 2024-05-03
date_of_transfer_to_archive 2024-05-07
description Short reads
dna_treatment 4 Bioruptor cycles
experimental_design Capture probes
facility BRF
family Elapidae
file_type FASTQ
flowcell_id 222VTMLT1
flowcell_type Novaseq X
folder_name 20240305_AusARG_BRF_222VTMLT1
genotypic_sex not determined
genus Hydrophis
habitat unknown
identified_by RS Lucas
insert_size_range 150bp PE
institution_name Australian National University
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455559
library_index_id p7_UDI_1143
library_index_id_dual p5_UDI_1143
library_index_seq ACTACGGTAG
library_index_seq_dual TTGCAACATG
library_layout paired end
library_location EBL Freezer
library_ng_ul 1.9
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTACGGTAGATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACTTGCAACATGACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 7
library_pcr_reps 4
library_prep_date 2024-03-28
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon Capture
lifestage not determined
location_text Kanthaya Beach
material_conc_ng_ul 23.0
material_extracted_by Liz Broady
material_extraction_date 2023-02-09
material_extraction_method Salt extraction
material_extraction_type DNA
metadata_revision_date 2024-11-15
metadata_revision_filename AusARG_Metadata_master_QCIF_20241115_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 192
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics unknown
project_aim Phylogenomics
sample_custodian Kate Sanders
sample_id 102.100.100/454078
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq X
sequencing_platform Illumina
source_population NA
species lapemoides
specimen_id CAS216443
specimen_id_description Australian National University
state_or_region Rakhine State
subspecies NA
taxon_id 8684
taxonomic_group Elapidae
ticket BPAOPS-1578
tissue_collection unknown
tissue_number CAS216443
tissue_preservation ethanol
tissue_type liver
type_status NA
voucher_or_tissue_number CAS216443
wild_captive wild
work_order 13078