Solomons Small-eyed Snake, Phylogenomics, Illumina Capture, unknown
Dataset size is: 562.04 MiB
This dataset is currently under a short embargo period until May 3, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2025-05-03 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | https://biocache.ala.org.au/occurrences/NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
certainty | NA |
class | Reptilia |
collection_method | unknown |
collector | unknown |
collector_sample_id | unknown |
common_name | Solomons Small-eyed Snake |
country | Papua New Guinea |
data_context | Phylogenomics |
data_custodian | Scott Keogh |
data_type | Illumina Capture |
dataset_id | 102.100.100/351864 |
date_of_transfer | 2024-05-03 |
date_of_transfer_to_archive | 2024-05-07 |
description | Short reads |
dna_treatment | 2 Bioruptor cycles |
experimental_design | Capture probes |
facility | BRF |
family | Elapidae |
file_type | FASTQ |
flowcell_id | 222VTMLT1 |
flowcell_type | Novaseq X |
folder_name | 20240305_AusARG_BRF_222VTMLT1 |
genotypic_sex | not determined |
genus | Loveridgelaps |
habitat | unknown |
identified_by | unknown |
insert_size_range | 150bp PE |
institution_name | Australian National University |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/455557 |
library_index_id | p7_UDI_1141 |
library_index_id_dual | p5_UDI_1141 |
library_index_seq | GCCACCTGCG |
library_index_seq_dual | AGCATCAATT |
library_layout | paired end |
library_location | EBL Freezer |
library_ng_ul | 0.9 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCACCTGCGATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACAGCATCAATTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 7 |
library_pcr_reps | 4 |
library_prep_date | 2024-03-28 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | unknown |
location_text | NA |
material_conc_ng_ul | 8.7 |
material_extracted_by | Damien Esquerre |
material_extraction_date | 2022-07-26 |
material_extraction_method | Qiagen Silica Column Extraction |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 192 |
order | Squamata |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | NA |
project_aim | Phylogenomics |
sample_custodian | Scott Keogh |
sample_id | 102.100.100/411565 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
source_population | NA |
species | elapoides |
specimen_id | Loveridgelaps elapoides |
specimen_id_description | Australian National University |
state_or_region | NA |
taxon_id | 8602 |
taxonomic_group | reptile |
ticket | BPAOPS-1578 |
tissue_collection | Australian National University |
tissue_number | Loveridgelaps elapoides |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | unknown |
voucher_or_tissue_number | Loveridgelaps elapoides |
wild_captive | wild |
work_order | 13078 |