Phylogenomics, Illumina Capture
Dataset size is: 97.01 MiB
This dataset is currently under a short embargo period until May 3, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-05-03 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| analysis_software | Bcl2Fastq |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
| data_context | Phylogenomics |
| data_custodian | Scott Keogh |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351864 |
| date_of_transfer | 2024-05-03 |
| date_of_transfer_to_archive | 2024-05-07 |
| description | Short reads |
| dna_treatment | 3 Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| file_type | FASTQ |
| flowcell_id | 222VTMLT1 |
| flowcell_type | Novaseq X |
| folder_name | 20240305_AusARG_BRF_222VTMLT1 |
| genus | Simoselaps |
| insert_size_range | 150bp PE |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455541 |
| library_index_id | p7_UDI_1125 |
| library_index_id_dual | p5_UDI_1125 |
| library_index_seq | TCGCAGAAAG |
| library_index_seq_dual | CCCTGTACTT |
| library_layout | paired end |
| library_location | EBL Freezer |
| library_ng_ul | 0.9 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCAGAAAGATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACCCCTGTACTTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 7 |
| library_pcr_reps | 4 |
| library_prep_date | 2024-03-28 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon Capture |
| n_libraries_pooled | 192 |
| project_aim | Phylogenomics |
| sample_id | 102.100.100/454060 |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| species | littoralis |
| specimen_id | R115226 |
| ticket | BPAOPS-1578 |
| tissue_number | R115226 |
| work_order | 13078 |