Ord Curl Snake, Phylogenomics, Illumina Capture, unknown
Dataset size is: 1.38 GiB
This dataset is currently under a short embargo period until May 3, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2025-05-03 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
certainty | NA |
class | Reptilia |
collection_method | unknown |
collector | unknown |
collector_sample_id | unknown |
common_name | Ord Curl Snake |
country | Australia |
data_context | Phylogenomics |
data_custodian | Scott Keogh |
data_type | Illumina Capture |
dataset_id | 102.100.100/351864 |
date_of_transfer | 2024-05-03 |
date_of_transfer_to_archive | 2024-05-07 |
description | Short reads |
dna_treatment | 5 Bioruptor cycles |
experimental_design | Capture probes |
facility | BRF |
family | Elapidae |
file_type | FASTQ |
flowcell_id | 222VTMLT1 |
flowcell_type | Novaseq X |
folder_name | 20240305_AusARG_BRF_222VTMLT1 |
genotypic_sex | not determined |
genus | Suta |
habitat | unknown |
identified_by | unknown |
insert_size_range | 150bp PE |
institution_name | Museum and Art Gallery of the Northern Territory |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/455536 |
library_index_id | p7_UDI_1120 |
library_index_id_dual | p5_UDI_1120 |
library_index_seq | TTAGTGAATT |
library_index_seq_dual | CGCGAAGGGA |
library_layout | paired end |
library_location | EBL Freezer |
library_ng_ul | 3.7 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGTGAATTATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACCGCGAAGGGAACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 7 |
library_pcr_reps | 2 |
library_prep_date | 2024-03-28 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | not determined |
location_text | unknown |
material_conc_ng_ul | 16.5 |
material_extracted_by | Liz Broady |
material_extraction_date | 2023-02-09 |
material_extraction_method | Salt extraction |
material_extraction_type | DNA |
metadata_revision_date | 2024-05-22 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 192 |
order | Squamata |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Phylogenomics |
sample_custodian | Scott Keogh |
sample_id | 102.100.100/454055 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
source_population | NA |
species | ordensis |
specimen_id | MAGNT R85942 |
specimen_id_description | Museum and Art Gallery of the Northern Territory |
state_or_region | Northern Territory |
subspecies | NA |
taxon_id | 2762595 |
taxonomic_group | Elapidae |
ticket | BPAOPS-1578 |
tissue_collection | Museum and Art Gallery of the Northern Territory Reptile Collection |
tissue_number | R85942 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | NA |
voucher_or_tissue_number | R85942 |
wild_captive | wild |
work_order | 13078 |