Ord Curl Snake, Phylogenomics, Illumina Capture, unknown

Elapidae, Suta ordensis, MAGNT R85942, Elapidae, Project Lead: Scott Keogh

Dataset size is: 1.38 GiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2025-05-03
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url NA
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/
certainty NA
class Reptilia
collection_method unknown
collector unknown
collector_sample_id unknown
common_name Ord Curl Snake
country Australia
data_context Phylogenomics
data_custodian Scott Keogh
data_type Illumina Capture
dataset_id 102.100.100/351864
date_of_transfer 2024-05-03
date_of_transfer_to_archive 2024-05-07
description Short reads
dna_treatment 5 Bioruptor cycles
experimental_design Capture probes
facility BRF
family Elapidae
file_type FASTQ
flowcell_id 222VTMLT1
flowcell_type Novaseq X
folder_name 20240305_AusARG_BRF_222VTMLT1
genotypic_sex not determined
genus Suta
habitat unknown
identified_by unknown
insert_size_range 150bp PE
institution_name Museum and Art Gallery of the Northern Territory
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455536
library_index_id p7_UDI_1120
library_index_id_dual p5_UDI_1120
library_index_seq TTAGTGAATT
library_index_seq_dual CGCGAAGGGA
library_layout paired end
library_location EBL Freezer
library_ng_ul 3.7
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGTGAATTATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACCGCGAAGGGAACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 7
library_pcr_reps 2
library_prep_date 2024-03-28
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon Capture
lifestage not determined
location_text unknown
material_conc_ng_ul 16.5
material_extracted_by Liz Broady
material_extraction_date 2023-02-09
material_extraction_method Salt extraction
material_extraction_type DNA
metadata_revision_date 2024-05-22
metadata_revision_filename AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 192
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics unknown
project_aim Phylogenomics
sample_custodian Scott Keogh
sample_id 102.100.100/454055
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq X
sequencing_platform Illumina
source_population NA
species ordensis
specimen_id MAGNT R85942
specimen_id_description Museum and Art Gallery of the Northern Territory
state_or_region Northern Territory
subspecies NA
taxon_id 2762595
taxonomic_group Elapidae
ticket BPAOPS-1578
tissue_collection Museum and Art Gallery of the Northern Territory Reptile Collection
tissue_number R85942
tissue_preservation ethanol
tissue_type unknown
type_status NA
voucher_or_tissue_number R85942
wild_captive wild
work_order 13078