Phylogenomics, Illumina Capture

Ephalophis greyae, R102113, Scott Keogh

Dataset size is: 955.94 MiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2025-05-03
Access Control Mode date
Sequence Data Type Illumina Capture
analysis_software Bcl2Fastq
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/
data_context Phylogenomics
data_custodian Scott Keogh
data_type Illumina Capture
dataset_id 102.100.100/351864
date_of_transfer 2024-05-03
date_of_transfer_to_archive 2024-05-07
description Short reads
dna_treatment 5 Bioruptor cycles
experimental_design Capture probes
facility BRF
file_type FASTQ
flowcell_id 222VTMLT1
flowcell_type Novaseq X
folder_name 20240305_AusARG_BRF_222VTMLT1
genus Ephalophis
insert_size_range 150bp PE
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455534
library_index_id p7_UDI_1118
library_index_id_dual p5_UDI_1118
library_index_seq AGGAGTTCTA
library_index_seq_dual GCTGGGCGAC
library_layout paired end
library_location EBL Freezer
library_ng_ul 1.6
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGAGTTCTAATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACGCTGGGCGACACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 7
library_pcr_reps 4
library_prep_date 2024-03-28
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon Capture
n_libraries_pooled 192
project_aim Phylogenomics
sample_id 102.100.100/454053
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq X
sequencing_platform Illumina
species greyae
specimen_id R102113
ticket BPAOPS-1578
tissue_number R102113
work_order 13078