Rosen's Snake, Phylogenomics, Illumina Capture, unknown
Dataset size is: 1.38 GiB
This dataset is currently under a short embargo period until May 3, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2025-05-03 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | 91277063-4b5d-4c01-8167-165334400941 |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
certainty | NA |
class | Reptilia |
collection_method | unknown |
collector | B Bush |
collector_sample_id | unknown |
common_name | Rosen's Snake |
country | Australia |
data_context | Phylogenomics |
data_custodian | Scott Keogh |
data_type | Illumina Capture |
dataset_id | 102.100.100/351864 |
date_of_transfer | 2024-05-03 |
date_of_transfer_to_archive | 2024-05-07 |
decimal_latitude_public | -21.983333 |
decimal_longitude_public | 118.833333 |
description | Short reads |
dna_treatment | 5 Bioruptor cycles |
experimental_design | Capture probes |
facility | BRF |
family | Elapidae |
file_type | FASTQ |
flowcell_id | 222VTMLT1 |
flowcell_type | Novaseq X |
folder_name | 20240305_AusARG_BRF_222VTMLT1 |
genotypic_sex | not determined |
genus | Suta |
habitat | unknown |
identified_by | Ken P Aplin |
insert_size_range | 150bp PE |
institution_name | Western Australian Museum |
latitude | -21.983333 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/455466 |
library_index_id | p7_UDI_1050 |
library_index_id_dual | p5_UDI_1050 |
library_index_seq | CGCTGTGGTT |
library_index_seq_dual | ATCTTCGAAT |
library_layout | paired end |
library_location | EBL Freezer |
library_ng_ul | 2.9 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTGTGGTTATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACATCTTCGAATACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 9 |
library_pcr_reps | 4 |
library_prep_date | 2024-03-28 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | not determined |
location_text | 42KM NNE Auski Roadhouse |
longitude | 118.833333 |
material_conc_ng_ul | 10.2 |
material_extracted_by | Liz Broady |
material_extraction_date | 2023-02-09 |
material_extraction_method | Salt extraction |
material_extraction_type | DNA |
metadata_revision_date | 2024-05-22 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx |
method_of_determination | unknown |
n_libraries_pooled | 192 |
order | Squamata |
phenotypic_sex | male |
phylum | Chordata |
prior_genetics | unknown |
project_aim | Phylogenomics |
sample_custodian | Scott Keogh |
sample_id | 102.100.100/453985 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq X |
sequencing_platform | Illumina |
source_population | NA |
species | fasciata |
species_name | Suta fasciata |
specimen_id | WAM R113619 |
specimen_id_description | Western Australian Museum |
state_or_region | Western Australia |
subspecies | NA |
taxon_id | 529716 |
taxonomic_group | Elapidae |
ticket | BPAOPS-1578 |
tissue_collection | Western Australian Museum Herpetology Collection |
tissue_number | R113619 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | NA |
voucher_or_tissue_number | R113619 |
wild_captive | wild |
work_order | 13078 |