Shine's Whipsnake, Phylogenomics, Illumina Capture, unknown

Elapidae, Demansia shinei, MAGNT R37967, Elapidae, Project Lead: Scott Keogh

Dataset size is: 1.97 GiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2025-05-03
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url 7d536d74-af40-425e-bd5b-5684df2b959b
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/
certainty NA
class Reptilia
collection_date 2018-03-14
collection_method unknown
collector unknown
collector_sample_id unknown
common_name Shine's Whipsnake
country Australia
data_context Phylogenomics
data_custodian Scott Keogh
data_type Illumina Capture
dataset_id 102.100.100/351864
date_of_transfer 2024-05-03
date_of_transfer_to_archive 2024-05-07
decimal_latitude_public -19.4609
decimal_longitude_public 131.21116
description Short reads
dna_treatment 5 Bioruptor cycles
experimental_design Capture probes
facility BRF
family Elapidae
file_type FASTQ
flowcell_id 222VTMLT1
flowcell_type Novaseq X
folder_name 20240305_AusARG_BRF_222VTMLT1
genotypic_sex not determined
genus Demansia
habitat unknown
identified_by C Jolly
insert_size_range 150bp PE
institution_name Museum and Art Gallery of the Northern Territory
latitude -19.4609
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/455432
library_index_id p7_UDI_1016
library_index_id_dual p5_UDI_1016
library_index_seq CAATCATCAG
library_index_seq_dual GCACTTACAT
library_layout paired end
library_location EBL Freezer
library_ng_ul 11.1
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAATCATCAGATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACGCACTTACATACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 9
library_pcr_reps 4
library_prep_date 2024-03-28
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon Capture
lifestage not determined
location_text 22km N of Tennant Creek, Stuart Highway, Barkly Region
longitude 131.21116
material_conc_ng_ul 7.18
material_extracted_by Liz Broady
material_extraction_date 2023-03-03
material_extraction_method Macherey-Nagel Plate Extraction Kit
material_extraction_type DNA
metadata_revision_date 2024-05-22
metadata_revision_filename AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 192
order Squamata
phenotypic_sex not determined
phylum Chordata
prior_genetics unknown
project_aim Phylogenomics
sample_custodian Scott Keogh
sample_id 102.100.100/453951
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq X
sequencing_platform Illumina
source_population NA
species shinei
species_name Demansia shinei
specimen_id MAGNT R37967
specimen_id_description Museum and Art Gallery of the Northern Territory
state_or_region Northern Territory
subspecies NA
taxon_id 3047314
taxonomic_group Elapidae
ticket BPAOPS-1578
tissue_collection Museum and Art Gallery of the Northern Territory Reptile Collection
tissue_number R37967
tissue_preservation ethanol
tissue_type unknown
type_status NA
voucher_or_tissue_number R37967
wild_captive wild
work_order 13078