Mangrove Seasnake, Phylogenomics, Illumina Capture, unknown
Dataset size is: 476.09 MiB
This dataset is currently under a short embargo period until May 3, 2025 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2025-05-03 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| access_rights | No restrictions |
| ala_specimen_url | f9dd8f57-52a4-4943-ba00-a532d26110d8 |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1578/20240503_AusARG_BRF_351864_222VTMLT1/ |
| certainty | NA |
| class | Reptilia |
| collection_method | unknown |
| collector | RJ Teale |
| collector_sample_id | unknown |
| common_name | Mangrove Seasnake |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Scott Keogh |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351864 |
| date_of_transfer | 2024-05-03 |
| date_of_transfer_to_archive | 2024-05-07 |
| description | Short reads |
| dna_treatment | 3 Bioruptor cycles |
| experimental_design | Capture probes |
| facility | BRF |
| family | Elapidae |
| file_type | FASTQ |
| flowcell_id | 222VTMLT1 |
| flowcell_type | Novaseq X |
| folder_name | 20240305_AusARG_BRF_222VTMLT1 |
| genotypic_sex | not determined |
| genus | Ephalophis |
| habitat | unknown |
| identified_by | G Harold |
| insert_size_range | 150bp PE |
| institution_name | Western Australian Museum |
| library_comments | NA |
| library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
| library_id | 102.100.100/455418 |
| library_index_id | p7_UDI_1002 |
| library_index_id_dual | p5_UDI_1002 |
| library_index_seq | GCCTGAAGAA |
| library_index_seq_dual | CCGGAGGGTC |
| library_layout | paired end |
| library_location | EBL Freezer |
| library_ng_ul | 6.6 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCTGAAGAAATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACCCGGAGGGTCACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 9 |
| library_pcr_reps | 4 |
| library_prep_date | 2024-03-28 |
| library_prepared_by | Liz Broady |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon Capture |
| lifestage | adult |
| location_text | Yarney Station, Pump 1 |
| material_conc_ng_ul | 4.63 |
| material_extracted_by | Liz Broady |
| material_extraction_date | 2023-02-09 |
| material_extraction_method | Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-05-22 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx |
| method_of_determination | unknown |
| n_libraries_pooled | 192 |
| order | Squamata |
| phenotypic_sex | female |
| phylum | Chordata |
| prior_genetics | unknown |
| project_aim | Phylogenomics |
| sample_custodian | Scott Keogh |
| sample_id | 102.100.100/453937 |
| sample_quality | unknown |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | 300 cycles |
| sequencing_model | NovaSeq X |
| sequencing_platform | Illumina |
| source_population | NA |
| species | greyae |
| specimen_id | WAM R157939 |
| specimen_id_description | Western Australian Museum |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 663306 |
| taxonomic_group | Elapidae |
| ticket | BPAOPS-1578 |
| tissue_collection | Western Australian Museum Herpetology Collection |
| tissue_number | R157939 |
| tissue_preservation | ethanol |
| tissue_type | unknown |
| type_status | NA |
| voucher_or_tissue_number | R157939 |
| wild_captive | wild |
| work_order | 13078 |