Eyrean Earless Dragon, Phylogenomics, Illumina Capture, unknown
Dataset size is: 223.44 MiB
This dataset is currently under a short embargo period until November 13, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-11-13 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1517/20231113_AusARG_BRF_351862_HVL5GDRX3/ |
certainty | NA |
class | Reptilia |
collection_date | 2001-11-05 |
collection_method | NA |
collector | NA |
collector_sample_id | NA |
common_name | Eyrean Earless Dragon |
country | Australia |
data_context | Phylogenomics |
data_custodian | Jane Melville |
data_type | Illumina Capture |
dataset_id | 102.100.100/351862 |
date_of_transfer | 2023-11-14 |
date_of_transfer_to_archive | 2023-11-16 |
description | Short reads |
dna_treatment | 60 sec sonication |
experimental_design | Capture probes |
facility | BRF |
family | Agamidae |
file_type | FASTQ |
flowcell_id | HVL5GDRX3 |
flowcell_type | Novaseq SP |
folder_name | 20231113_AusARG_BRF_351862_HVL5GDRX3 |
genotypic_sex | not determined |
genus | Tympanocryptis |
habitat | NA |
identified_by | NA |
insert_size_range | 150bp PE |
institution_name | Commonwealth Scientific and Industrial Research Organisation |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/454940 |
library_index_id | p7_UDI_0955 |
library_index_id_dual | p5_UDI_0955 |
library_index_seq | CGTATATAGA |
library_index_seq_dual | CGACTCTACA |
library_layout | paired end |
library_location | ANU EBL Freezer |
library_ng_ul | 18.5387270354 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTATATAGAATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACTGTAGAGTCGACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 12 |
library_pcr_reps | 1 |
library_prep_date | 2023-05-09 |
library_prepared_by | Leo Tedechi / Jo Sumner |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | unknown |
location_text | 54km east Mulga Park Station, Mulga PK RD |
material_conc_ng_ul | 1397.0 |
material_extracted_by | NA |
material_extraction_method | NA |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 284 |
order | Squamata |
phenotypic_sex | unknwon |
phylum | Chordata |
project_aim | Phylogenomics |
sample_custodian | Jane Melville |
sample_id | 102.100.100/412177 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | tetraporophora |
specimen_id | ANWC R6135 |
specimen_id_description | Australian National Wildlife Collection |
state_or_region | Northern Territory |
subspecies | NA |
taxon_id | 206609 |
taxonomic_group | Squamata |
ticket | BPAOPS-1517 |
tissue_collection | Australian National Wildlife Collection |
tissue_number | R6135 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | NA |
voucher_or_tissue_number | ANWC R6135 |
wild_captive | wild |
work_order | 13073 |