Lined Earless Dragon, Phylogenomics, Illumina Capture, unknown
Dataset size is: 350.23 MiB
This dataset is currently under a short embargo period until November 13, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-11-13 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | 87e366f8-ed7d-46e7-b050-0155ede4eed0 |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1517/20231113_AusARG_BRF_351862_HVL5GDRX3/ |
certainty | NA |
class | Reptilia |
collection_date | 1974-05-26 |
collection_method | NA |
collector | NA |
collector_sample_id | NA |
common_name | Lined Earless Dragon |
country | Australia |
data_context | Phylogenomics |
data_custodian | Jane Melville |
data_type | Illumina Capture |
dataset_id | 102.100.100/351862 |
date_of_transfer | 2023-11-14 |
date_of_transfer_to_archive | 2023-11-16 |
decimal_latitude_public | -35.33 |
decimal_longitude_public | 142.83 |
description | Short reads |
dna_treatment | 60 sec sonication |
experimental_design | Capture probes |
facility | BRF |
family | Agamidae |
file_type | FASTQ |
flowcell_id | HVL5GDRX3 |
flowcell_type | Novaseq SP |
folder_name | 20231113_AusARG_BRF_351862_HVL5GDRX3 |
genotypic_sex | not determined |
genus | Tympanocryptis |
habitat | NA |
identified_by | Dr Jane E Melville - Museums Victoria |
insert_size_range | 150bp PE |
institution_name | Museums Victoria |
latitude | -35.33 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/454931 |
library_index_id | p7_UDI_0946 |
library_index_id_dual | p5_UDI_0946 |
library_index_seq | CACTCGCGTG |
library_index_seq_dual | ATAGATAAGC |
library_layout | paired end |
library_location | ANU EBL Freezer |
library_ng_ul | 6.2031485592 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACTCGCGTGATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACGCTTATCTATACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 12 |
library_pcr_reps | 1 |
library_prep_date | 2023-05-09 |
library_prepared_by | Leo Tedechi / Jo Sumner |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | unknown |
location_text | Lake Tyrrell |
longitude | 142.83 |
material_conc_ng_ul | 500.0 |
material_extracted_by | NA |
material_extraction_method | NA |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 284 |
order | Squamata |
phenotypic_sex | unknwon |
phylum | Chordata |
project_aim | Phylogenomics |
sample_custodian | Jane Melville |
sample_id | 102.100.100/412169 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | petersi |
species_name | Tympanocryptis petersi |
specimen_id | NMV D74168 |
specimen_id_description | Museums Victoria Herpetology Collection |
state_or_region | Victoria |
subspecies | NA |
taxon_id | 2656638 |
taxonomic_group | Squamata |
ticket | BPAOPS-1517 |
tissue_collection | Museums Victoria Herpetology Collection |
tissue_number | D74168 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | PARATYPE |
voucher_or_tissue_number | NMV D74168 |
wild_captive | wild |
work_order | 13073 |