Phylogenomics, Illumina Capture, unknown
Dataset size is: 258.66 MiB
This dataset is currently under a short embargo period until November 13, 2024 to enable primary access by research partners.
If you would like access during this period please contact us here or contact the project lead directly (see details in the table below) for collaboration opportunities.
Data and Resources
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2024-11-13 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | NA |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1517/20231113_AusARG_BRF_351862_HVL5GDRX3/ |
certainty | NA |
class | Reptilia |
collection_method | NA |
collector | NA |
collector_sample_id | NA |
country | Australia |
data_context | Phylogenomics |
data_custodian | Jane Melville |
data_type | Illumina Capture |
dataset_id | 102.100.100/351862 |
date_of_transfer | 2023-11-14 |
date_of_transfer_to_archive | 2023-11-16 |
decimal_latitude_public | -28.3197222222 |
decimal_longitude_public | 139.2205555556 |
description | Short reads |
dna_treatment | 60 sec sonication |
experimental_design | Capture probes |
facility | BRF |
family | Agamidae |
file_type | FASTQ |
flowcell_id | HVL5GDRX3 |
flowcell_type | Novaseq SP |
folder_name | 20231113_AusARG_BRF_351862_HVL5GDRX3 |
genotypic_sex | not determined |
genus | Tympanocryptis |
habitat | NA |
identified_by | NA |
insert_size_range | 150bp PE |
institution_name | South Australian Museum |
latitude | -28.3197222222 |
library_comments | NA |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/454930 |
library_index_id | p7_UDI_0945 |
library_index_id_dual | p5_UDI_0945 |
library_index_seq | TACCAACCAC |
library_index_seq_dual | CATCCCATAC |
library_layout | paired end |
library_location | ANU EBL Freezer |
library_ng_ul | 10.7695575162 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACCAACCACATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACGTATGGGATGACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 12 |
library_pcr_reps | 1 |
library_prep_date | 2023-05-09 |
library_prepared_by | Leo Tedechi / Jo Sumner |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon Capture |
lifestage | unknown |
location_text | 12k SSW Red Lake Yard |
longitude | 139.2205555556 |
material_conc_ng_ul | 493.2 |
material_extracted_by | NA |
material_extraction_method | NA |
material_extraction_type | DNA |
metadata_revision_date | 2024-01-25 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 284 |
order | Squamata |
phenotypic_sex | unknwon |
phylum | Chordata |
prior_genetics | NA |
project_aim | Phylogenomics |
sample_custodian | Jane Melville |
sample_id | 102.100.100/412168 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | argillosa |
species_name | Tympanocryptis argillosa |
specimen_id | SAMA R49360 |
specimen_id_description | South Australian Museum Herpetology Collection |
state_or_region | South Australia |
subspecies | NA |
taxon_id | 2656636 |
taxonomic_group | Squamata |
ticket | BPAOPS-1517 |
tissue_collection | South Australian Museum Herpetology Collection |
tissue_number | R49360 |
tissue_preservation | ethanol |
tissue_type | unknown |
type_status | NA |
voucher_or_tissue_number | SAMA R49360 |
wild_captive | wild |
work_order | 13073 |