Eyrean Earless Dragon, Phylogenomics, Illumina Capture, unknown

Agamidae, Tympanocryptis tetraporophora, NMV D74046, Squamata, Project Lead: Jane Melville

Dataset size is: 464.97 MiB

Log in or Register to access resource
 
 

 

Data and Resources

Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2024-11-13
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url e84c61e6-0318-4a8f-b810-c0ed998af1cd
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1517/20231113_AusARG_BRF_351862_HVL5GDRX3/
certainty NA
class Reptilia
collection_date 1976-01-03
collection_method NA
collector Danielle L Edwards | Museum Victoria
collector_sample_id NA
common_name Eyrean Earless Dragon
country Australia
data_context Phylogenomics
data_custodian Jane Melville
data_type Illumina Capture
dataset_id 102.100.100/351862
date_of_transfer 2023-11-14
date_of_transfer_to_archive 2023-11-16
decimal_latitude_public -17.935
decimal_longitude_public 139.302
description Short reads
dna_treatment 60 sec sonication
experimental_design Capture probes
facility BRF
family Agamidae
file_type FASTQ
flowcell_id HVL5GDRX3
flowcell_type Novaseq SP
folder_name 20231113_AusARG_BRF_351862_HVL5GDRX3
genotypic_sex not determined
genus Tympanocryptis
habitat NA
identified_by NA
insert_size_range 150bp PE
institution_name Museums Victoria
latitude -17.935
library_comments NA
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/454928
library_index_id p7_UDI_0943
library_index_id_dual p5_UDI_0943
library_index_seq GCTCTCGCTT
library_index_seq_dual CAATGAACGT
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 38.9485241742
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCTCTCGCTTATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACACGTTCATTGACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 12
library_pcr_reps 1
library_prep_date 2023-05-09
library_prepared_by Leo Tedechi / Jo Sumner
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon Capture
lifestage unknown
location_text Road to Gregory Downs, 8 km S of Carpentaria Highway
longitude 139.302
material_conc_ng_ul 429.0
material_extracted_by NA
material_extraction_method NA
material_extraction_type DNA
metadata_revision_date 2024-01-25
metadata_revision_filename AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 284
order Squamata
phenotypic_sex unknwon
phylum Chordata
project_aim Phylogenomics
sample_custodian Jane Melville
sample_id 102.100.100/412166
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6000
sequencing_platform Illumina
source_population NA
species tetraporophora
species_name Tympanocryptis tetraporophora
specimen_id NMV D74046
specimen_id_description Museums Victoria Herpetology Collection
state_or_region Queensland
subspecies NA
taxon_id 206609
taxonomic_group Squamata
ticket BPAOPS-1517
tissue_collection Museums Victoria Herpetology Collection
tissue_number D74046
tissue_preservation ethanol
tissue_type unknown
type_status NA
voucher_or_tissue_number NMV D74046
wild_captive wild
work_order 13073