Pretty Worm-lizard, Phylogenomics, Illumina Capture, liver
Dataset size is: 772.08 MiB
Data and Resources
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
Access Control Date | 2023-07-03 |
Access Control Mode | date |
Sequence Data Type | Illumina Capture |
access_rights | No restrictions |
ala_specimen_url | https://biocache.ala.org.au/occurrences/509edec1-5628-4d2e-9de5-3ebeb4c5811e |
analysis_software | Bcl2Fastq |
ancillary_notes | NA |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1367/20220701_AusARG_BRF_351836_HGJFGDRX2/ |
certainty | NA |
class | Reptilia |
collection_method | unknown |
collector | Maryan |
common_name | Pretty Worm-lizard |
country | Australia |
data_context | Phylogenomics |
data_custodian | Ian Brennan |
data_type | Illumina Capture |
dataset_id | 102.100.100/351836 |
dataset_url | WAS BPAOPS-1297 |
date_of_transfer | 2022-07-03 |
date_of_transfer_to_archive | 2022-07-19 |
decimal_latitude_public | -31.23 |
decimal_longitude_public | 116.301667 |
description | Short reads |
dna_treatment | 50 Biorupter cycles |
experimental_design | Capture probes |
facility | BRF |
facility_project_code | NA |
family | Pygopodidae |
file_type | FASTQ |
flowcell_id | HGJFGDRX2 |
flowcell_type | Novaseq SP |
folder_name | 20220701_AusARG_BRF_351836_HGJFGDRX2 |
genotypic_sex | not determined |
genus | Aprasia |
habitat | UNDER LOG |
identified_by | MARYAN,B. |
insert_size_range | 150bp PE |
institution_name | Western Australian Museum |
latitude | -31.23 |
library_comments | First post library prep PCR didn't produce enough DNA, so second half of libraries were PCR'd with 12 cycles, split across 2 reactions and combined before cleaning. |
library_construction_protocol | NEXTFLEX_2.0_RapidDNASeq |
library_id | 102.100.100/354643 |
library_index_id | P7_UDI_0701 |
library_index_id_dual | P5_UDI_0701 |
library_index_seq | GCCAGCCCAG |
library_index_seq_dual | AACGACGTGG |
library_layout | paired end |
library_location | ANU EBL Freezer |
library_ng_ul | 6.2 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACGACGTGGATCTCGTATGCCGTCTTCTGCTTG |
library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACACGCCAGCCCAGACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 12 |
library_pcr_reps | 2 |
library_prep_date | 2022-05-17 |
library_prepared_by | Liz Broady |
library_selection | Hybrid Selection |
library_source | GENOMIC |
library_strategy | Targeted-Capture |
library_type | Exon capture |
lifestage | Adult |
location_text | Bindoon military training area |
longitude | 116.301667 |
material_conc_ng_ul | 70.0 |
material_extracted_by | Ian G Brennan |
material_extraction_date | 2021-07-01 |
material_extraction_method | Salt extraction |
material_extraction_type | DNA |
metadata_revision_date | 2024-05-22 |
metadata_revision_filename | AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx |
method_of_determination | NA |
n_libraries_pooled | 33 |
order | Squamata |
phenotypic_sex | not determined |
phylum | Chordata |
prior_genetics | NA |
project_aim | Phylogenomics |
sample_custodian | Paul Doughty |
sample_id | 102.100.100/410795 |
sample_quality | unknown |
sequencing_facility | Biomolecular Research Facility - ANU |
sequencing_kit_chemistry_version | 300 cycles |
sequencing_model | NovaSeq 6000 |
sequencing_platform | Illumina |
source_population | NA |
species | pulchella |
species_name | Aprasia pulchella |
specimen_id | WAM R153937 |
specimen_id_description | Western Australian Museum Herpetology Collection |
state_or_region | Western Australia |
subspecies | NA |
taxon_id | 207575 |
taxonomic_group | reptile |
ticket | BPAOPS-1367 |
tissue_collection | Western Australian Museum Herpetology Collection |
tissue_number | R153937 |
tissue_preservation | ethanol |
tissue_type | liver |
type_status | unknown |
voucher_or_tissue_number | R153937 |
wild_captive | wild |
work_order | 13047 |