Neck-barred Delma, Phylogenomics, Illumina Capture, liver

Pygopodidae, Delma haroldi, WAM R156703, reptile, Project Lead: Ian Brennan

Dataset size is: 1012.82 MiB

Log in or Register to access resource
 
 

 

Data and Resources

This data is made available openly under a Creative Commons Attribution license. Please see the initiative Data Policy for attribution information.

Additional Info Show Blank Fields

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members
Access Control Date 2023-07-03
Access Control Mode date
Sequence Data Type Illumina Capture
access_rights No restrictions
ala_specimen_url https://biocache.ala.org.au/occurrences/1c851c6f-9a20-44b4-a4a6-9beb90cd6919
analysis_software Bcl2Fastq
ancillary_notes NA
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1367/20220701_AusARG_BRF_351836_HGJFGDRX2/
certainty NA
class Reptilia
collection_method unknown
collector Ladyman, M. Et
common_name Neck-barred Delma
country Australia
data_context Phylogenomics
data_custodian Ian Brennan
data_type Illumina Capture
dataset_id 102.100.100/351836
dataset_url WAS BPAOPS-1297
date_of_transfer 2022-07-03
date_of_transfer_to_archive 2022-07-19
decimal_latitude_public -23.141389
decimal_longitude_public 119.591667
description Short reads
dna_treatment 50 Biorupter cycles
experimental_design Capture probes
facility BRF
facility_project_code NA
family Pygopodidae
file_type FASTQ
flowcell_id HGJFGDRX2
flowcell_type Novaseq SP
folder_name 20220701_AusARG_BRF_351836_HGJFGDRX2
genotypic_sex not determined
genus Delma
habitat unknown
identified_by Doughty,P.
insert_size_range 150bp PE
institution_name Western Australian Museum
latitude -23.141389
library_comments First post library prep PCR didn't produce enough DNA, so second half of libraries were PCR'd with 12 cycles, split across 2 reactions and combined before cleaning.
library_construction_protocol NEXTFLEX_2.0_RapidDNASeq
library_id 102.100.100/354640
library_index_id P7_UDI_0698
library_index_id_dual P5_UDI_0698
library_index_seq GAAGTGCCAA
library_index_seq_dual CACGGCAAAT
library_layout paired end
library_location ANU EBL Freezer
library_ng_ul 40.6
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGGCAAATATCTCGTATGCCGTCTTCTGCTTG
library_oligo_sequence_dual AATGATACGGCGACCACCGAGATCTACACGAAGTGCCAAACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 12
library_pcr_reps 2
library_prep_date 2022-05-17
library_prepared_by Liz Broady
library_selection Hybrid Selection
library_source GENOMIC
library_strategy Targeted-Capture
library_type Exon capture
lifestage Adult
location_text 38KM NW NEWMAN
longitude 119.591667
material_conc_ng_ul 62.6
material_extracted_by Ian G Brennan
material_extraction_date 2021-07-01
material_extraction_method Salt extraction
material_extraction_type DNA
metadata_revision_date 2024-01-25
metadata_revision_filename AusARG_Metadata_master_QCIF_20240125_FORDATAPORTAL.xlsx
method_of_determination NA
n_libraries_pooled 33
order Squamata
phenotypic_sex male
phylum Chordata
prior_genetics NA
project_aim Phylogenomics
sample_custodian Paul Doughty
sample_id 102.100.100/410792
sample_quality unknown
sequencing_facility Biomolecular Research Facility - ANU
sequencing_kit_chemistry_version 300 cycles
sequencing_model NovaSeq 6000
sequencing_platform Illumina
source_population NA
species haroldi
species_name Delma haroldi
specimen_id WAM R156703
specimen_id_description Western Australian Museum Herpetology Collection
state_or_region Western Australia
subspecies NA
taxon_id 207581
taxonomic_group reptile
ticket BPAOPS-1367
tissue_collection Western Australian Museum Herpetology Collection
tissue_number R156703
tissue_preservation ethanol
tissue_type liver
type_status unknown
voucher_or_tissue_number R156703
wild_captive wild
work_order 13047