Keeled Legless lizard, Phylogenomics, Illumina Capture, liver
Dataset size is: 921.25 MiB
Data and Resources
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
-
350790_AHHVV2AFX2_TCCATGACGG_S2_... Metadata Only FASTQ
This data is made available openly under a Creative Commons Attribution license.
Please see the initiative
Data Policy
for attribution information.
Additional Info Show Blank Fields
| Field | Value |
|---|---|
| Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
| Resource Permissions | organization_member_after_embargo:date_of_transfer_to_archive:365:ausarg-consortium-members |
| Access Control Date | 2022-05-04 |
| Access Control Mode | date |
| Sequence Data Type | Illumina Capture |
| access_rights | No restrictions |
| ala_specimen_url | https://ozcam.ala.org.au/occurrences/e68dbc9a-ba74-474f-bb92-ec4fbf3af2e7 |
| analysis_software | Bcl2Fastq |
| ancillary_notes | NA |
| associated_media | NA |
| barcode_id | NA |
| base_url | https://downloads-qcif.bioplatforms.com/bpa/ausarg_staging/exon_capture/brf/BPAOPS-1066/ |
| certainty | high |
| class | Reptilia |
| collection_date | 2003-11-04 |
| collection_method | Pit Trap |
| collector | Paul Doughty | Brad Maryan |
| collector_sample_id | NA |
| common_name | Keeled Legless lizard |
| country | Australia |
| data_context | Phylogenomics |
| data_custodian | Ian Brennan |
| data_type | Illumina Capture |
| dataset_id | 102.100.100/351767 |
| date_of_transfer | 2021-05-04 |
| date_of_transfer_to_archive | 2021-05-10 |
| decimal_latitude_public | -31.654722 |
| decimal_longitude_public | 115.923889 |
| description | Short reads |
| dna_treatment | Fragmentation by Covaris |
| experimental_design | Perkin Elmer DNA-Seq Rapid 2.0 Libraries with Arbor (Daicel) Biosciences Exon Capture - dual index |
| facility | BRF |
| facility_project_code | NA |
| facility_sample_id | 349780_AHHVV2AFX2_TCCATGACGG |
| family | Pygopodidae |
| file_type | FASTQ |
| flowcell_id | AHHVV2AFX2 |
| flowcell_type | Mid output 300 cycles |
| folder_name | 20210504_AusARG_BRF_AHHVV2AFX2 |
| genotypic_sex | not determined |
| genus | Pletholax |
| habitat | unknown |
| identified_by | Brad Maryan |
| insert_size_range | 150 bp PE |
| institution_name | Western Australian Museum |
| latitude | -31.654722 |
| library_comments | Full library reaction; qubit 13.1 ng/uL |
| library_construction_protocol | NEXTFLEX Rapid DNA-Seq Kit 2.0 |
| library_id | 102.100.100/350790 |
| library_index_id | P7_UDI_0002 |
| library_index_id_dual | P5_UID_0002 |
| library_index_seq | TCCATGACGG |
| library_index_seq_dual | AACGTCTCCG |
| library_layout | paired end |
| library_location | ANU EBL Freezer |
| library_ng_ul | 13.1 |
| library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCAC tccatgacggATCTCGTATGCCGTCTTCTGCTTG |
| library_oligo_sequence_dual | AATGATACGGCGACCACCGAGATCTACAC aacgtctccgACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| library_pcr_cycles | 4 |
| library_pcr_reps | 1 |
| library_prep_date | 2021-02-18 |
| library_prepared_by | Ian Brennan |
| library_selection | Hybrid Selection |
| library_source | GENOMIC |
| library_strategy | Targeted-Capture |
| library_type | Exon capture |
| lifestage | adult |
| location_text | Muchea Air Weapons Range |
| longitude | 115.923889 |
| material_conc_ng_ul | 116.0 |
| material_extracted_by | Ian Brennan |
| material_extraction_date | 2020-09-01 |
| material_extraction_method | Salt extraction |
| material_extraction_type | DNA |
| metadata_revision_date | 2024-05-22 |
| metadata_revision_filename | AusARG_Metadata_master_QCIF_20240522_FORDATAPORTAL.xlsx |
| method_of_determination | hemipenis eversion |
| n_libraries_pooled | 32 |
| order | Squamata |
| phenotypic_sex | male |
| phylum | Chordata |
| prior_genetics | NA |
| project_aim | Phylogenomics |
| sample_custodian | Paul Doughty |
| sample_id | 102.100.100/349780 |
| sample_quality | unknown |
| sequencing_facility | Biomolecular Research Facility - ANU |
| sequencing_kit_chemistry_version | NextSeq 500 midoutput 300 cycles V2.5 |
| sequencing_model | NextSeq 500 |
| sequencing_platform | Illumina |
| source_population | NA |
| species | gracilis |
| species_name | Pletholax gracilis |
| specimen_id | WAM R154023 |
| specimen_id_description | Western Australian Museum |
| state_or_region | Western Australia |
| subspecies | NA |
| taxon_id | 207565 |
| taxonomic_group | lizard | gecko |
| ticket | BPAOPS-1066 |
| tissue_collection | Herpetology (R) |
| tissue_number | WAM R154023 |
| tissue_preservation | -80C | ethanol |
| tissue_type | liver |
| type_status | non type |
| voucher_or_tissue_number | WAM R154023 |
| wild_captive | wild |
| work_order | 13018 |