JSON

OMG Novaseq Raw 102.100.100/54313 HT25VDSXX CAAGCTAG-ACATAGCG

Pseudomys desertor, Z21333 QB Australia Northern Territory

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
access_rights no restrictions
ala_species_name
ala_specimen_url https://biocache.ala.org.au/occurrences/a57a4ca1-380d-459d-83a3-69564542b8df
ancillary_notes DNA conc method = Qubit, DNA total µg = 106.92
archive_ingestion_date 2019-09-17
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-856/
birth_date unknown
bpa_dataset_id 102.100.100/52615
bpa_library_id 102.100.100/54313
bpa_sample_id 102.100.100/41597
bpa_work_order 40047.0
class Mammalia
collection_date 2011-07-30
collection_method elliott trap
collector Kevin Rowe
collector_sample_id KCR1274
common_name Desert Mouse
conservation_sample no
conservation_status NA
contextual_data_submission_date
coord_uncertainty_metres 200.0
country Australia
custodian Kevin Rowe | Museums Victoria
data_custodian Kevin C. Rowe
data_generated 2019-09-17
data_type Illumian FASTQ
dataset_url (ingested)
date_of_transfer 2019-09-17
death_date 2011-07-30
description NovaSeq 6000- Whole Genome - 41600 and 41597
dna_conc_ng_ul 594.0
dna_extracted_by Kevin Rowe
dna_extraction_date 2019-05-15
dna_extraction_method Qiagen DNEasy
dna_treatment Qiagen DNEasy Extraction
experimental_design 1x NovaSeq 6000 150 bp paired-end reads
facility_sample_id 9406-2
family Muridae
file 41597_HT25VDSXX_CAAGCTAG-ACATAGCG_S1_L003_R1, 41597_HT25VDSXX_CAAGCTAG-ACATAGCG_S1_L003_R2
flowcell_id HT25VDSXX
folder_name 20190912_AGRF_BPA_OMG_HT25VDSXX
genome_sample yes
genome_status DNA extracted
genus Pseudomys
habitat Spinifex desert
identified_by Kevin Rowe
institution_name Museums Victoria
latitude 136.25366
library_comments DNA conc method = Qubit, DNA total µg = 12.96 (41596) or 106.92 (41597)
library_index_id UDI0007
library_index_sequence CAAGCTAG-ACATAGCG
library_location AGRF
library_ng_ul 37.5
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 8.0
library_pcr_reps
library_prep_date 2019-08-28
library_prep_method Illumina TruSeq DNA Nano
library_prepared_by Justin Crockett
library_status Sequenced
library_type Illumina TruSeq DNA
life_stage adult organism
location_generalisation
location_text Barkly Tableland, Brunnette Downs, Bore 45
longitude -18.63133
n_libraries_pooled 1.0
omg_project Whole Genomes
order Rodentia
phylogenomic_sample no
phylogenomic_status NA
phylum Chordata
prior_genetics unknown
sample_quality high molecular weight
sample_submission_date 2019-09-17
sequence_length 150 bp PE
sequencing_facility AGRF
sequencing_platform NovaSeq
sex male
software_version Illumina RTA v3.4.4
source_population unknown
species desertor
species_name Pseudomys desertor
state_or_region Northern Territory
subspecies NA
taxon_id
taxonomic_group rodent
ticket BPAOPS-856
tissue_collection Mammalogy
tissue_number NMV Z21333 QB
tissue_preservation RNALater
tissue_type spleen
trace_lab no
type_status
voucher_id NMV_C36879
voucher_number NMV C36879
voucher_or_tissue_number Z21333 QB
wild_captive wild