
OMG Novaseq Raw 102.100.100/54313 HT25VDSXX CAAGCTAG-ACATAGCG
Data and Resources
Additional Info
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member |
access_rights | no restrictions |
ala_species_name | |
ala_specimen_url | https://biocache.ala.org.au/occurrences/a57a4ca1-380d-459d-83a3-69564542b8df |
ancillary_notes | DNA conc method = Qubit, DNA total µg = 106.92 |
archive_ingestion_date | 2019-09-17 |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-856/ |
birth_date | unknown |
bpa_dataset_id | 102.100.100/52615 |
bpa_library_id | 102.100.100/54313 |
bpa_sample_id | 102.100.100/41597 |
bpa_work_order | 40047.0 |
class | Mammalia |
collection_date | 2011-07-30 |
collection_method | elliott trap |
collector | Kevin Rowe |
collector_sample_id | KCR1274 |
common_name | Desert Mouse |
contextual_data_submission_date | |
coord_uncertainty_metres | 200.0 |
country | Australia |
custodian | Kevin Rowe | Museums Victoria |
data_custodian | Kevin C. Rowe |
data_generated | 2019-09-17 |
data_type | Illumian FASTQ |
dataset_url | (ingested) |
date_of_transfer | 2019-09-17 |
ddrad_data | no |
ddrad_dataset_ids | NA |
death_date | 2011-07-30 |
description | NovaSeq 6000- Whole Genome - 41600 and 41597 |
dna_conc_ng_ul | 594.0 |
dna_extracted_by | Kevin Rowe |
dna_extraction_date | 2019-05-15 |
dna_extraction_method | Qiagen DNEasy |
dna_treatment | Qiagen DNEasy Extraction |
exon_capture_data | no |
exon_capture_dataset_ids | NA |
experimental_design | 1x NovaSeq 6000 150 bp paired-end reads |
facility_sample_id | 9406-2 |
family | Muridae |
file | 41597_HT25VDSXX_CAAGCTAG-ACATAGCG_S1_L003_R1, 41597_HT25VDSXX_CAAGCTAG-ACATAGCG_S1_L003_R2 |
flowcell_id | HT25VDSXX |
folder_name | 20190912_AGRF_BPA_OMG_HT25VDSXX |
genome_data | yes |
genome_dataset_ids | 52615.0 |
genus | Pseudomys |
habitat | Spinifex desert |
identified_by | Kevin Rowe |
institution_name | Museums Victoria |
latitude | 136.25366 |
library_comments | DNA conc method = Qubit, DNA total µg = 12.96 (41596) or 106.92 (41597) |
library_index_id | UDI0007 |
library_index_sequence | CAAGCTAG-ACATAGCG |
library_location | AGRF |
library_ng_ul | 37.5 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 8.0 |
library_pcr_reps | |
library_prep_date | 2019-08-28 |
library_prep_method | Illumina TruSeq DNA Nano |
library_prepared_by | Justin Crockett |
library_status | Sequenced |
library_type | Illumina TruSeq DNA |
life_stage | adult organism |
location_generalisation | |
location_text | Barkly Tableland, Brunnette Downs, Bore 45 |
longitude | -18.63133 |
n_libraries_pooled | 1 |
omg_project | Whole Genomes |
order | Rodentia |
phylum | Chordata |
prior_genetics | unknown |
sample_quality | high molecular weight |
sample_submission_date | 2019-09-17 |
sequence_length | 150 bp PE |
sequencing_facility | AGRF |
sequencing_platform | NovaSeq |
sex | male |
software_version | Illumina RTA v3.4.4 |
source_population | unknown |
species | desertor |
species_name | Pseudomys desertor |
state_or_region | Northern Territory |
subspecies_or_variant | |
taxon_id | 221914 |
taxonomic_group | rodent |
ticket | BPAOPS-856 |
tissue_collection | Mammalogy |
tissue_number | NMV Z21333 QB |
tissue_preservation | RNALater |
tissue_type | spleen |
trace_lab | no |
type_status | |
voucher_id | NMV_C36879 |
voucher_number | NMV C36879 |
voucher_or_tissue_number | NMV C36879 |
wild_captive | wild |