JSON

OMG Novaseq Raw 102.100.100/54311 HT25VDSXX TGGATCGA-GTGCGATA

Mastacomys fuscus, Z27367 QA Australia Victoria

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
access_rights no restrictions
ala_species_name
ala_specimen_url https://biocache.ala.org.au/occurrences/b05dc893-7ec9-4e01-8908-1235d2585a40
ancillary_notes DNA conc method = Qubit, DNA total µg = 10.332
archive_ingestion_date 2019-09-17
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-856/
birth_date unknown
bpa_dataset_id 102.100.100/52613
bpa_library_id 102.100.100/54311
bpa_sample_id 102.100.100/41600
bpa_work_order 40047.0
class Mammalia
collection_date 2013-11-28
collection_method elliott trap
collector Karen Roberts
collector_sample_id KKR173
common_name Broad-toothed rat
conservation_sample no
conservation_status NA
contextual_data_submission_date
coord_uncertainty_metres 200.0
country Australia
custodian Kevin Rowe | Museums Victoria
data_custodian Kevin C. Rowe
data_generated 2019-09-17
data_type Illumian FASTQ
dataset_url (ingested)
date_of_transfer 2019-09-17
death_date 2013-11-28
description NovaSeq 6000- Whole Genome - 41600 and 41597
dna_conc_ng_ul 57.4
dna_extracted_by Kevin Rowe
dna_extraction_date 2019-05-15
dna_extraction_method Qiagen DNEasy
dna_treatment Qiagen DNEasy Extraction
experimental_design 1x NovaSeq 6000 150 bp paired-end reads
facility_sample_id 9406-3
family Muridae
file 41600_HT25VDSXX_TGGATCGA-GTGCGATA_S2_L003_R1, 41600_HT25VDSXX_TGGATCGA-GTGCGATA_S2_L003_R2
flowcell_id HT25VDSXX
folder_name 20190912_AGRF_BPA_OMG_HT25VDSXX
genome_sample yes
genome_status DNA extracted
genus Mastacomys
habitat Alpine meadow
identified_by Kevin Rowe
institution_name Museums Victoria
latitude 148.12485
library_comments DNA conc method = Qubit, DNA total µg = 10.332 (41600) or 0.72 (41601)
library_index_id UDI0008
library_index_sequence TGGATCGA-GTGCGATA
library_location AGRF
library_ng_ul 29.1
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 8.0
library_pcr_reps
library_prep_date 2019-08-28
library_prep_method Illumina TruSeq DNA Nano
library_prepared_by Justin Crockett
library_status Sequenced
library_type Illumina TruSeq DNA
life_stage adult organism
location_generalisation
location_text Alpine National Park, Davies Plain Camp, 16.91km SE of Mt Pinnibar summit, and 6.70km NE of Davies Plain Track and Kings Plain 4WD Track junction
longitude -36.65264
n_libraries_pooled 1.0
omg_project Whole Genomes
order Rodentia
phylogenomic_sample no
phylogenomic_status NA
phylum Chordata
prior_genetics unknown
sample_quality Qiagen Standard Extraction Quality
sample_submission_date 2019-09-17
sequence_length 150 bp PE
sequencing_facility AGRF
sequencing_platform NovaSeq
sex female
software_version Illumina RTA v3.4.4
source_population unknown
species fuscus
species_name Mastacomys fuscus
state_or_region Victoria
subspecies NA
taxon_id
taxonomic_group rodent
ticket BPAOPS-856
tissue_collection Mammalogy
tissue_number NMV Z27367 QA
tissue_preservation RNALater
tissue_type spleen
trace_lab no
type_status
voucher_id NMV_C37546
voucher_number NMV C37546
voucher_or_tissue_number Z27367 QA
wild_captive wild