JSON

OMG Novaseq Raw 102.100.100/53912 HJKTTDSXX AACAGGTT-ATACCAAG

Macroderma gigas, ABTC50959 Australia Northern Territory

Data and Resources

Additional Info

Field Value
Geospatial Coverage

Dataset extent

Map tiles & Data by OpenStreetMap, under CC BY SA.
Resource Permissions organization_member
access_rights location information restricted
ala_species_name
ala_specimen_url NA
ancillary_notes NA
archive_ingestion_date 2019-03-25
associated_media NA
barcode_id NA
base_url https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-816/
birth_date unknown
bpa_dataset_id 102.100.100/52609
bpa_library_id 102.100.100/53912
bpa_sample_id 102.100.100/41194
bpa_work_order 40026.0
class Mammalia
collection_date 2015-01-08
collection_method unknown
collector unknown
collector_sample_id NA
common_name Ghost bat
conservation_sample no
conservation_status NA
contextual_data_submission_date
coord_uncertainty_metres unknown
country Australia
custodian Kyle Armstrong
data_custodian Kym Ottewell | Kyle Armstrong
data_generated 2019-03-25
data_type Illumina FASTQ
dataset_url (ingested)
date_of_transfer 2019-03-20
death_date unknown
description NovaSeq 6000- Whole Genome - 41193 and 41194
dna_conc_ng_ul
dna_extracted_by Kyle Armstrong
dna_extraction_date 2018-11-29
dna_extraction_method unknown
dna_treatment NA
experimental_design replicate DNA extractions for sample 41194 pooled for library prep, 50 Gb/sample (NovaSeq 6000 S4, 300 cycles)
facility_sample_id 8893_02
family Megadermatidae
file 53912_ABTC50959_pool_HJKTTDSXX_AACAGGTT-ATACCAAG_L001_R1.fastq.gz | 53912_ABTC50959_pool_HJKTTDSXX_AACAGGTT-ATACCAAG_L001_R2.fastq.gz
flowcell_id HJKTTDSXX
folder_name 20190313_AGRF_BPA_OMG_HJKTTDSXX
genome_sample yes
genome_status submitted for QC
genus Macroderma
habitat unknown
identified_by unknown
institution_name Australian Biological Tissue Collection, South Australian Museum
latitude -13.9
library_comments libraries prepared from pooled replicated DNA extractions
library_index_id UDI0051
library_index_sequence AACAGGTT-ATACCAAG
library_location AGRF
library_ng_ul 30.4
library_oligo_sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACCTGTTATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACATACCAAGACACTCTTTCCCTACACGACGCTCTTCCGATCT
library_pcr_cycles 8.0
library_pcr_reps
library_prep_date 2018-12-17
library_prep_method TruSeq DNA Nano
library_prepared_by Amy Longva
library_status Sequencing completed
library_type genome short read
life_stage unknown
location_generalisation 10km
location_text 1km S Pine Creek
longitude 131.8
n_libraries_pooled 1.0
omg_project unknown
order Chiroptera
phylogenomic_sample no
phylogenomic_status NA
phylum Chordata
prior_genetics unknown
sample_quality high quality
sample_submission_date 2019-03-20
sequence_length 150 bp PE
sequencing_facility AGRF
sequencing_platform NovaSeq 6000
sex female
software_version bcl2fastq pipeline version 2.20.0.422
source_population unknown
species gigas
species_name Macroderma gigas
state_or_region Northern Territory
subspecies NA
taxon_id
taxonomic_group bat
ticket BPAOPS-816
tissue_collection Mammal
tissue_number ABTC50959
tissue_preservation -80C
tissue_type liver
trace_lab no
type_status
voucher_id ABTC50959
voucher_number no voucher
voucher_or_tissue_number ABTC50959
wild_captive unknown