
OMG Novaseq Raw 102.100.100/53911 HG2W3DSXX CCAAGTCT-AAGGATGA
Data and Resources
Additional Info
Field | Value |
---|---|
Geospatial Coverage |
Dataset extentMap tiles & Data by OpenStreetMap, under CC BY SA.
|
Resource Permissions | organization_member |
access_rights | location information restricted |
ala_species_name | |
ala_specimen_url | NA |
ancillary_notes | Different DNA extracts used for genome and exon capture |
archive_ingestion_date | 2019-03-25 |
associated_media | NA |
barcode_id | NA |
base_url | https://downloads-qcif.bioplatforms.com/bpa/omg_staging/genomics-novaseq/BPAOPS-815/ |
birth_date | unknown |
bpa_dataset_id | 102.100.100/52606 |
bpa_library_id | 102.100.100/53911 |
bpa_sample_id | 102.100.100/41193 |
bpa_work_order | 40026.0 |
class | Mammalia |
collection_date | 2015-01-08 |
collection_method | unknown |
collector | unknown |
collector_sample_id | NA |
common_name | Ghost bat |
contextual_data_submission_date | |
coord_uncertainty_metres | unknown |
country | Australia |
custodian | Kyle Armstrong |
data_custodian | Kym Ottewell | Kyle Armstrong |
data_generated | 2019-03-25 |
data_type | Illumina FASTQ |
dataset_url | (ingested) |
date_of_transfer | 2019-03-20 |
ddrad_data | no |
ddrad_dataset_ids | NA |
death_date | unknown |
description | NovaSeq 6000- Whole Genome - 41193 and 41194 |
dna_conc_ng_ul | |
dna_extracted_by | Kyle Armstrong |
dna_extraction_date | 2018-11-29 |
dna_extraction_method | unknown |
dna_treatment | NA |
exon_capture_data | no |
exon_capture_dataset_ids | NA |
experimental_design | replicate DNA extractions for sample 41193 pooled for library prep, 50 Gb/sample (NovaSeq 6000 S4, 300 cycles) |
facility_sample_id | 8893_01 |
family | Megadermatidae |
file | 53911_ABTC50957_pool_HG2W3DSXX_CCAAGTCT-AAGGATGA_L001_R1.fastq.gz | 53911_ABTC50957_pool_HG2W3DSXX_CCAAGTCT-AAGGATGA_L001_R2.fastq.gz |
flowcell_id | HG2W3DSXX |
folder_name | 20190313_AGRF_BPA_OMG_HG2W3DSXX |
genome_data | yes |
genome_dataset_ids | 52606 | 52608 |
genus | Macroderma |
habitat | unknown |
identified_by | unknown |
institution_name | Australian Biological Tissue Collection, South Australian Museum |
latitude | -13.9 |
library_comments | libraries prepared from pooled replicated DNA extractions |
library_index_id | UDI0013 |
library_index_sequence | CCAAGTCT-AAGGATGA |
library_location | AGRF |
library_ng_ul | 40.4 |
library_oligo_sequence | GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGACTTGGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACAAGGATGAACACTCTTTCCCTACACGACGCTCTTCCGATCT |
library_pcr_cycles | 8.0 |
library_pcr_reps | |
library_prep_date | 2018-12-17 |
library_prep_method | TruSeq DNA Nano |
library_prepared_by | Amy Longva |
library_status | Sequencing completed |
library_type | genome short read |
life_stage | unknown |
location_generalisation | 10km |
location_text | 1km S Pine Creek |
longitude | 131.8 |
n_libraries_pooled | 1 |
omg_project | unknown |
order | Chiroptera |
phylum | Chordata |
prior_genetics | unknown |
sample_quality | high quality |
sample_submission_date | 2019-03-20 |
sequence_length | 150 bp PE |
sequencing_facility | AGRF |
sequencing_platform | NovaSeq 6000 |
sex | male |
software_version | bcl2fastq pipeline version 2.20.0.422 |
source_population | unknown |
species | gigas |
species_name | Macroderma gigas |
state_or_region | Northern Territory |
subspecies_or_variant | |
taxon_id | 9411 |
taxonomic_group | bat |
ticket | BPAOPS-815 |
tissue_collection | Mammal |
tissue_number | ABTC50957 |
tissue_preservation | frozen -80C |
tissue_type | liver | heart | kidney |
trace_lab | no |
type_status | |
voucher_id | ABTC50957 |
voucher_number | no voucher |
voucher_or_tissue_number | ABTC50957 |
wild_captive | unknown |